Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-snap-gene-0.65
Orientation:
(-)
Number of Exons:
1
Description :
Calmodulin-binding WW domain protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
IQ motif, EF-hand binding site9.066PS50096
IQ motif, EF-hand binding site7.071PS50096
IQ motif, EF-hand binding site7.968PS50096
IQ motif, EF-hand binding site9.908PS50096
IQ motif, EF-hand binding site9.743PS50096
Zinc finger, B-box9.044PS50119
IQ motif, EF-hand binding site8.7PS50096
HmmSmart predictionP-Valprediction_id
IQ motif, EF-hand binding site74SM00015
IQ motif, EF-hand binding site34SM00015
IQ motif, EF-hand binding site0.0033SM00015
IQ motif, EF-hand binding site12SM00015
IQ motif, EF-hand binding site30SM00015
IQ motif, EF-hand binding site30SM00015
IQ motif, EF-hand binding site0.013SM00015
IQ motif, EF-hand binding site36SM00015
IQ motif, EF-hand binding site0.11SM00015
IQ motif, EF-hand binding site170SM00015
IQ motif, EF-hand binding site400SM00015
IQ motif, EF-hand binding site1.1SM00015
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1571
*** None ***
PositionContextScore
162SRRRFRR|EL0.717
461ASNRVRR|LA0.628
536VLRRRNR|SA0.581
539RRNRSAR|RI0.519
803GADRHNR|FV0.597
1012ELHRYRR|LV0.583
1101ERERLRR|EA0.649
1215RTRRKKR|WT0.769
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
zinc ion bindingGO:0008270IEA
intracellularGO:0005622IEA
*** None ***
*** None ***
Sequence
        4716 bases(100 bases per row)
ATGATACAAcTGGCTCTTGAAGATATAAACATCTTGAACATACCCAGTGCACCGGTGGAGTTGGCGGAGCGCCAATCCATTTTCTCTGTACCAGAGAACT
TGCCACCAGATGTGCAAGCCTTTCTGCATCAAGACCACAACCGCCTCATCACTCTGAAGAAAAGCGCATTCGAGCAAGTGCGCGCTGCAGAAAAGCGCGT
AGATCAGACGCTGTGTGACATCAAGCAGTGGCTTCCTGTCGAGTTGCTGTATGATTTTGGACTTGGAAAATTTGCGTCACCAGCTCAACAGCGGGCTGCA
TTTACATTACATAAAGTGAGGCAACGTTTGAGTCGCGGTCTACTCGTCAGGGGTATGGAGAAGTGGAAGCACGTAGTTGCTGAAATGCGACTAGCCACAG
CGTTGCGATCTGCCCTCGTCCTTCAGTGCTGGTGGCGACAAATACTAGCGATCCGCATTCTCAATAGCCGGCGGAGAtTTCGAAGAGAACTTGAAAGACG
ACAGTGTGCCATGTTGCGCTTAATGGCAAGCAAAAGGAACCGAAGTGCAACAATAATCACGGGTGCAATCCAAAGATACGCTTCCAGGTGCAAATGTAGA
CGGATACTAAGGCATGAGAAGGCCGCTCGTCTCATACAGACTTTTTGGCGACAACAGCAAGCCCTCTGGGCTGCTATTCGGCGCCGATTATACCAGGAGA
AACGAAACAATGCAGCTATTACCATACAAAGATGCATCCGAGGTTATCTCGCCCGTCGACTTCGTCAGCTCTTGATAAAGATCAATCGAGTAGAGGAGCA
ACGTCTGGCGAGGATACTAGAAAGATCTATACGTATGGGAGATCACTATCGACTTGGGGCTGCTGTTACGATCCAGAGGGCTATTCGGGGATGGATACAC
CGACGTATTGCTGGCCTAAAGCGGCGTCGGGCACAGTTCGAGCGTGATAAAGTCCAAATTCTGAAAGTGCAAGCCTACTGTCGTGGCCAAAAAGCCCGGC
GTTGGGTACGACGCTACATAGAGAAACGACCGAAAGCCGTCTTGACAATTCAGTGCGCTTGGCGATGCTTCGTTGCGCATGGAGTGAAGAAGCACTTACT
CAGCTGCCAACGTACGGAAGTGATGAATAGCAAGTCaAAAAAACCAAGAAAGCGTCCAGATGTGAAAACCCTGGTAACCTCTGGGTTTGTCAGCAAAGTT
CCGAAAGCCTCAAATGTAATGATGAAGGTTGCCAAGAAAGATGGCGGGCCAAGCCGACGCGAGATAAACGCCGCCATCAAAATCCAAGCGTTATGGCGAG
GACGAAGATCACGCCAGAGGATGAAGTACGTCCGGGCTCGTGAGAGAGAGTTATCACGTCGAGCGAGTAATCGTGTAAGACGGTTGGCCGcAACATGCAT
TCAAcGTCATGTTCGAGGAGTTCAGGCACGTGGAAGAGTgTGGGGTATGATAGTGAATCATGCGGCTGCAACTATTCAGAGCACGTGGCGTGGCCACGTG
ACACGACGTGAACTTTTCCGAATGCAAGCTGCGCTCAAAGCCATCATGAAAGTGCAGGTACGCTGGAGAAGAACCCGAAGCCAGGAGGTTCTTCGACGAC
GCAACAGAAGTGCGCGGCGCATCCAGTCTGCCTATCGTTGtTTTTTGGGATGGAAATGGTTGTACTCTGCTGTCCGACGTCAGCAATATTTATCCGAAGA
ACATGCAATGGGCGCTGCTCTGATGAAGCTAACAAGGAAACGCGTTGAAAATGAGCTACTAATCCAGAGCTTCTTTCATCATGATGTGCAAATCCTGGAT
CATTCAAACGATGGTAAATCGTCACAAATTGGTGACACTGATATCAAGTCTGTCCAGCGATCCCTCTACAAGGTTGATTTGGCAAAGCGAAAGTGGAAAA
GACGTGGATATGATGGTGTATGGCAAGAGATATATCGTGACATTTCAGGGAACTCTTTCGAAATCGACAATTCACGGTTTACTCGCTTCCTGAAGGGTTT
ACCACGGGCTTTCATAAACCAGCGCAGCTTCCCCATCCAGACAGTTGATCTCATATTCACAAAAATGAAGGAGCCGAAGTCGAGAACCATCACGTTTCCT
CGCTTCAACAAAGCCATGGCAATGGTTTGGCAAGAGAAACTCTCATCGCAACCTATGAAGAAGCACGGGCAAACGATAACCGATGTCGCTTCAACTGATT
TGCTGGCAGAGTCTCCTACCTTAGTGAAGAAGAAGCAGGAAGAAGACAACTTTCtTTGGTTCATGCAAGAGTACGTCTTGCCGTCGTCTCTCTACAACGG
CAAATATCGGAAACTTCTTGACGAGGAATGCACTAGGCGACTTGAATGGGCAGTCTCCATTCTTCGAAGATTTGCGCTTCGTATTTCAGGTGCTGATCGT
CACAACCGGTTTGTGGAGATTCATCGACGTCAGAGACTTGAGCAGCAACGTATATATGCTACACGAATCCTCCAAAAACACTTTAGACTGTACAAGTTTC
GTTCGACTTTGAAAGCTACGCTTGCTAAAATGTTTATCGAATTCATTGATTACAAGAATCGGAGCGTCCGCTTCGAACACATTGAGACGCGGAAGGCGGT
TGTAATTAGTACGACTCATCGcCGTCCAGCATTTTTACGTGGCGTCCGCTGCGACTTAGTCATTCCACTACCATTCCCTGGAGAAGAGTTTCGTGCTTTT
TGTGAGCGTCACGAGTCTGCCAAAGATCCTACGAAGAAAGTTGCTGCGAAGTACTACTGCGTGGAATGTGAAGAGGTTTCGTGCGCAACTTGCTTTGATC
GTGATCATGACAAACGATTTACATTCCAGTCACACGGACGTCGGGTGATTGCCACTTGTAGTCATTGCAGAATTGAGACTGCGACTCGCGAATGCCTTCA
GTGTGGTGATGGCAAGGTTCCATTTTGTGATGCTTGCTTCCCTTTCGTGCACAATCAAACCAAGCTCGAAAATGATTCAAACAACCAAAATGGTGGGAAC
GAAAAGGCAGGAAAGGAATTACACCGATACCGACGTCTTGTGGTTGCTTGTGTGGAGTGTGACGAGAAGGTTGCACAGTGGATGTGCGATGTTTGCGAAG
ATGTATTCTGTAAGCGTTGTCTGTCTCGGCTACATGCTAAAGGGCACCGACAATCTCATCACTGCCATCGTTTGAGCTACTTTTCCGTGTTACAACAGAA
TGCTGAAAACAAACGCCTCAGGGATGCCCAGAAGCTACACGACCAGAAACGACACGAACGTGAAGCTAGACGTGCGGCAGAAGAGCGAGAGAGACTGCGT
CGTGAGGCTAGCGCGGTTAAGaTACAGTCGTTGGTGAGGTCATATCAGGCGCGCATGCGTGGaAAAGCTTACATGAAGCTTGTCCGCCAAACGAACGCAG
CCAAGGCTCAACGCATAAAAGACGAACGCGTTCGCCAGTCTTGGCTCTATCGAATCAAAAGTGTTGTAGGAATGCAACCCAATTTGAAGTCAGACACACA
AGAAGAGGCAGACGGAAAGCGAAGAAGAGTTGCTGCAATCAAGCGAACCCtTTTTTTctACAAGAACGAGGATGAACCCCTATACGACGACCCGATATCT
GGAGAGGGTAAATCCGCTTCAGCGAGAACAAGGCGaAAAAAGCGATGGACTAAGCGAGCACGAGCCGCTGTCGAGAAAGCTGCCAGAAGCTGGTTGGTAT
ACGGTGTTCAGGTTAAAGTAGTGCGAGGaAACGAGTGGAAGAACTGTGTCGGATCTATCGTGTCCACGCAAAATTTGTTCaATACGGGCCACGTTCtTGT
TTTCATCCCAGCCGCAAATCGAGCTATTGTTGTCAGTTGGGAAGACATTACTCCATATGATGAGGATGAAATCCTGCGCCAGCCGTATGTCGCCCCATCA
CGAGACGTTCTCGATGCGGCATCAGGCTTTTATGGAAAGCTTTCTCAGCACATTGATGGTGCAGCTCGTCGTGCAAAACTCCTGTATCTACaGAGTATCG
AATTTCATGATGTCGTTCAGTTTGcCTGGATTGTAGAGTACAATAAACTTGAAAAGAAGGAGGAGTACTGGAATGTTGTACTCAACAAACGAACTTTTGA
TATGCCCAAGGCGATGGTGCAGATCGAGCAAATGGAGCCAGATGTGAGAGAGAAGCTAGAAAAGCGTGTCGCGATTGCaAAAAGTAAACTGGTGCACTTG
CTGAATCCCTTCGTTCCTCACGGGAAAGATCGATTGGCTTATCGACGTTTCGCTATCGTGAATGTCCCTGTCGGGATAAAGACCATCAACTCAGAACCtA
TTTCAAGACTGCGGACTGAAGCTGAAGCAATGAGTTGTGCTCGATTTTGGCACGAAACCATTATCACAACACCGCAGATTGGTGAGAAGTATGCCGCTCG
CTTCCTTGCGTCGTGCACCAGCCCGTATTCAACCAAAGATTGCTGGTTTCTGGTGCGGCTATTGCAGTGGATTGAACTCCAGGACAGCGATACATTCGcC
AGTTTGACGAAGACATTCATGAGGAAATCCGCTGAGATTCATCAGTATATACTCACGGAGCTAGCACCGTTGATCGAAAAAGGAGAGCTAAAAGACGCTC
GTGTTGACTTTGAACGGCTGCTCAAACTGAAAGAAGAAACAATGCATTTACTCATATCGAAAGCTCAACAGGCAGCAGACGCTGCAGACGAAGCAACCAC
AGCCTCAACaAAGTAA