Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-snap-gene-0.51
Orientation:
(-)
Number of Exons:
1
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-372
*** None ***
PositionContextScore
106WVKRNKR|MT0.603
364VDMRMRR|TL0.575
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1119 bases(100 bases per row)
ATGGTCGTGAGAACGGAGGACGAGATCAAAGATGCTGAGGATGTTGAAGATGGTGAGATTATCGAGGAGCCGATAGAGGAAGATTCACCTGTGGATCCGC
GATCGCTGCCCCGTGAAGTACGCATTGCGAAGAGTATTGTGAGTTTGACTGAGTTCCAGGATGATGTCAAGGCGGGCAAGGTGGGCCGGCTCAAGACCAT
GACTAGAGCTGAGAGTATGCGACTCTATCGATCACCACTACCCCCGATCCCAGTACCTCTGGTGCCTGGCGAGACCGAGAGACAATACGAAGAGTGGTGG
GTCAAGCGAAATaAAAGAATGACACAGGAGGAGATTGAGGCGTATGAAATGGGACTGCTGGAGAGACGAATGCGAATCGAGTTTGCCGAGCTGAACGGAA
GAGGCATCGAATGGTTCGACACACGACGAGCTCGCTACGACGAATCAAACAGGAAGGGCGAGCACCGTTTGGTAGACCAAGACAGCTCAGAGAGTCTTAA
AGACAGAGCCACCCGTCACCCAGTACCAAATGAAGGACACAGACATCCCGAAGCTAAGTCTGTGGTCGACGCTAAGACCAAAGAACTGCTGCGTGTGTAC
AACGACATGAACGAGATGATCGTGTTGAACGAAGAAGTGCTAGAAATGGAGTGCAACCAGTTTAATGCTCTCTCTGGTTCGATGGACGCGCATGAAGCTG
CCGTATTCCAAAGCGAGAATGAAGAACTACGCGTTCTGATTCAAGACGAATACGAGCGCCGAAGTCTCGCAGTCGCGACTTTGATCCACCACATATTCCG
CGACCGACAGCAAGAGATTCGTGCTATGATTGAGAACCCTGAAGCAACTAACAACCTCGATGAACAGCGTGCAGTCCACAAGCGATGCGCAGGACTCGCA
TCAGATGCAGCGAAGAATCGAGCCAAATTGGAAGAGCTCCAAGCGGAGGTTGGTCATCAGAAGACAGACGCCCTGAGCCGACAAGAGAGAGAAGAAGCGA
CCACACGCACTACAAGAGCGATCGAAAGACTTGACCACGAAGAGCTGAAGGCCCTTGAGGGGCTTATACATGTGGACATGCGCATGCGGAGAACACTGGA
AACGATCATGACGAATTGA