Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-fgenesh-gene-1.4
Orientation:
(+)
Number of Exons:
1
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-483
*** None ***
PositionContextScore
191ARASSRR|SA0.628
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1452 bases(100 bases per row)
ATGACGTTGGACACGCTCACGCGCGTGCACGCCGAGAGCAAGCACGTCAAGCTCAAGGGCTCACTCGCGCTCACTCGAAGCGAGTTCCGAGGGCGACTAC
AACACGAGTCGGACCTCTTTCAGTCGTTAGATGGATCATCACCGTCTCCATCGTCGATCCTCCCGTTGAGCCCGATCTCCCACATCCCCAAGACCTCACC
GCCACAGCCGAATTCGCCCcTCGATGGAGAAGACCTTGTGCGAACCGAACGACTGAGACAGAGCTGCAAGCGAGTGCGAGTGTGGCGTCGACAAACCACG
AACCCGCTGCTGCCGTTCAAGCAGCAGCAGCTTGCGAGAGCCCACGGGAACACGATGACGACCGCTTTTAGCGgTCTCGTCATGGGCGgTCTTGGCTCCA
CGGCAACAGACCATCGCATGCACCTCTCGTTGCTCATGACGCTCATCGTCGATGTGTATGAACAGAAAATGGCCGCCGAAGtCGCGTCGGCCGGCGCCTT
GGCCGCCGGCATCAGCGAGTCGCTGCCCGAATtCGTGGCCAAGTTCATCACAGCGCGTGCATCGTCGCGACGCTCGGCAATCGACCAGCTCAACAGCATG
ATCGCAGTGCTGCTGCAGCCATCGACGCATGCTCGCGTGCGTTGCTTCGCGTCGCTTTGCGGCATTGACGACAAGTACAATCCACCGGAGAAGACCAAGG
CGTTTCtGCACATGGTGGAGACCATCCACcGCCACAAGGCCGCGGCCACTAGCAGCAGTGGCAGTGGCACACGAGCTGACGACCCGAcGGCCATGGCCGA
GGTCGTGTTTTACAACTTGGGCGTTCCACTGGGCGTCGCTCACAAAGTGATCGCCGAGCTGTTTGCGGACGAATACTACTGGAACTTCCGCTTCTGGCAC
TCGCATTTCCGAGAGCTGAGGCTCGACTATGCATGGCCCGGAAGCGCCAAGATCGAGTTGGATGACAAGGCTGCAAGTCTCATGGCGGTGACGCGGAACG
CGTCGCTCAACGCTGCCAAGAAGATTGATAGCGACGCGTTCCTGGAACTGCTATTGGACACATGGACCGAGCGTGCCAAAGCGCTGGCCGATGTGCTCGA
GGCGGCCACTGACACCGAGgAGCGGAAGGGCGAAGCCGCACTGGCCAACTCACAGGCAGTACAGGACGCACGCGGCCGCATCGCCCCGCTTACAGACACG
GAAAAGGCGCTATTCAACGAGCTAATCGGCGAGTTCTGGAACGCCGAGGTGCCGTGGGCGAGCAGTAAGATCCAGCGACGCGTGGCCAGCGCCTGCCTTC
CGACACGGCCATTGAGTGAGCTCGCGGCATTGtACAGGCAGTACGTCGCCGAACTGAGTGAGGAGAAGCAAGTGTGGCGCTGGGACGACTGGCCCTGGGA
TGCCGAGTGGGAGTGGGGGCTGCTTCTGGTTCGTGACGAGGAGCAGGCATAA