Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-fgenesh-gene-0.22
Orientation:
(-)
Number of Exons:
5
Description :
Deoxycytidylate deaminase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-378
*** None ***
PositionContextScore
106KRGRPRK|SD0.64
136SIARKKR|KM0.782
*** None ***
GO
*** None ***
KO ID
K01493
*** None ***
Sequence
        1395 bases(100 bases per row)
ATGGCGGCAAAGGCTCCAGCGACGGACGCGGCGGCTACGGGCCCAGAGCTCAAGGTCTCGGGGCgTAAGaTCAAGGAGCTGTTCTATACGGAGGTGGAGA
TGCCAGCGGCGGCAGATGGGGAGGAACAGCAGCCGCACTTCCGCTGTCGCTGTGGCAAGGTGCGCGCGCAGAGCCTCAAGCACGGGTACACCAACCTCAA
GCAGCACGTGGTGCAGAAGCACCCCGAGTGGCTAGCCGAGTGCACAGACGAGGTGGTGGCCAAGTCGCCGGGCCCGACCACGACCACGCCGCCTAAGAAG
CGTGGGCGCCCACGGAAGAGCGACGCCGCCATTACGCCGAAGAAGGAGGAAGTGGTGCCGGTGATTGAGACTGTGATCGAGTCGGCGTCCATCGCCCGGA
AGAAGCGCAAAATGGGCGCTGTTGCGGCGGCGGAGGCGGGACTGCAGGCAGAAGAGGACGAAGACAAGGAGAAAGAGAAGGAGAAGCCACGTACAGGCTC
CGAGTTTCCATCACCCTCGTCTTCGTCGGCTTCGATGACGAGTTCATCTGCCGCTGCTGCGACCACTGAGTCGAATTCAAACACCGTTGGTTACGCAGTG
TTCCCTGCAAGCAGCTCGTCGGTGGGCAATaGCGCCAAGAAGCGCACGGACTACATCTCGTGGGACGACTACTTCATGAGCGTCGCATTCCTTAGCGCCA
TGCGCTCCAAGGACCCATCAACTCAGGTCGGCGCGTGGTACGAACGACTCTGCTCTTGAGTATGACATTCGGCTACTCTAACCCTCTGACGTTCTGTAGC
ATTGTCAACGATGAGAAGAAGATCGTCGGCATCGGCTACAACGGCTTCCCCAACGGCTGCAGCGACGACACGCTGCCGTGGGCACGTGAGAGCAAGACCG
AGAACCCACTCGAAACCAAGTACCCGGTAGGATGCCTATATGGAGAATGTCTGCTCCTGGTGCTGATGGCTGCTCCTTTCGTGCTACAGTTCGTGTGTCA
CGCTGAGATGAACGCCATTCTGAACAAGAACTCGTCGGACCTCAAGGGCTGTACGGTGGGTCAATTCGATTGTGGTTGATGGAGTGACTTGCAGACTGAC
CGATGCGCTGGCTGATGGCAGATCTACaTCGCGCTTTTCCCtTGCAACGaGTGCGCCAAGCTCATTATCCAAAGCGGCATCAAGCACATCGTGTACCTCT
CCGACAAGTATCACGATGAGTGCGTCTTGTGTCTACTGTCTTCCTTTGCTTCTgTCGTgGTCACTGACCTCtTTGTCTGATTGTAGCTGGAAGATGGTCG
CATCGCGTCGCATGCTCGACATGGCTGGTGTCGAGTACCGCCAACACCACGTCGACAAGTCCAAGATTGTCATCGACTTCTCGTCCATCGAGTAG