Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-fgenesh-gene-1.11
Orientation:
(+)
Number of Exons:
1
Description :
ATP-binding Cassette (ABC) Superfamily
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
ABC transporter type 1, transmembrane domain34.727PS50929
ABC transporter-like24.67PS50893
HmmSmart predictionP-Valprediction_id
AAA+ ATPase domain1.3SM00382
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
285-346
402-694
1-261
370-378
262-284
347-369
379-401
*** None ***
PositionContextScore
231TIDRGSR|SI0.532
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
ATPase activityGO:0016887IEA
nucleotide bindingGO:0000166IEA
integral component of membraneGO:0016021IEA
transportGO:0006810IEA
KO ID
K05662
*** None ***
Sequence
        2082 bases(100 bases per row)
ATGACGCTGCTGCAGAGCCGCCGCGTGCTGCTGCgTGGGCTCCGTCACTTGGACCGCAGTCAGCCATGGGCCAGTCCCCTCGTACGACTCACAGCGCAGC
GTCCGCGCGGTCCGTTGTCACTCAGTGCGACGCTGGTCGGCAACGGCCGCACGCACCAGCGCGTTGTAtCGTTCGCGACGTCGGCGCTTAATGATGAGAA
GAAGAAGCATGAAGCAGAGAAAGCCAAGAAGGCGGCGGTCGTGAGCGACGACGAAGAGAACAAGGACACCACGAAGGAGATCCTCAGCTTCCTGCTTCGT
CACTTGTGGCCCAAGGAGAACACCCCGGAAGCCCGTGACATCAAGCAGAAAGTGCTGCTCTCGGGTGGGCTTGTGCTCGCGTCCAAGGCGCTTACGATCC
AAGTGCCGTTCATTTTCAAAGAGCTTGTGGATTCGATGAGTATTGCATCGACGGCGCTGTCGCAATCACCGGAAGTGACCATTCCCCTTGCGCTTGTGCT
CGGCTACGGTGTCGCACGCTTCACAGCGAACGCGTCGTCTGAACTCGCTAACGCAATCTTCGCGAGCGTGACGCAGAAGACCATCCGCTCGGTGGCTATC
CGCATTTTCGACCACCTGCACGCGATGGACCTCAAGTTCCACTTGGACCGACAGACAGGTGCCCTGGCCCGAACGATTGACCGTGGTTCGCGCTCCATTG
ACGTTGTGCTGCGCTCAATGGCATTCCGTGTGCTGCCGACGGCGCTGGAGATTGGCCTCGTGTCTACGATTATGGCTCAGAACTTTGGCATGCCGTACGT
TGGTGTCACGCTCGGCACTTTGACTGCCTACACGGCGTACACAGTTGTGGTCACGCAATGGCGTGATGGCATTCGTCGCCGTATGAACCAGATGGAGAAC
GAAGCGGCCGGTAAAGTCATCGACTCTCTGATGAACTACGAAACTGTGAAGTACTTTAACAACGAACGTCACGAGGCTGGGCGCTACGACGAGTCCCTCA
AGGGATACCAGAAGGCTGCGCTCAAGACACAGACGTCGCTGTCATTGCTGAACGCCGGACAGAACGGTATCTTCAGCATCGGCCTCACAACGATTATGTA
CATGGCGAGCCAAGGCATTGCTGCCGGCACTTTGACTGTCGGTGATCTGGTGCTGGTGAaCGGCCTCTTGTTCCAGCTCTCGATTCCGCTCAATTTTATC
GGTACGCTCTACCGTGAAGTGCGTCAGGCCACGACCGATATGGAGGCGATGTTCAAGCTTGGGACTGTCAAATCCAACTTACACTACAGCGAGAACCCGG
CCCGCTTGGAGGGTAAGCAACCAAAGTCCATTGAGTTCCGGGATGTCCAGTTCGCCTACCGCCCAGAGTTCCCTATTCTCAAGGGTGCGTCGTTCAAGGT
CGAACCAGGCAAGACCATTGGCATCGTTGGTACGAGTGGGTCTGGCAAATCGACGGTACTGCGTCTTCTGTACCGATTCTACGACCCACAGGCGGGTTCA
GTGCTCATCGATGGCAAGGACATTCGCGATTTGGACGTGCACGACTTGCGCAAGGCGATTGCCATTGTTCCACAAGACACGGTGCTCTTCAaCGACTCGA
TTTTCTACAACATCAACTACGGTCGCCTCGATGCCACGGAGCACGAAGTGCTTGAAGCTGCCCGCGTTTCCCAGATCCACAACTCGATCATGAACTTCCC
AGAGGGTTACGACACTCGCGTCGGTGAGCGTGGATTGAAGCTCTCGGGTGGTGAGAAGCAGCGTGTCGCTATCGCTCGTGCCATGCTcAaGGACGCTCCT
ATTCTGCTTTTCGACGAAGCCACAAGTGCCCTCGACTCGGAGACTGAGTCTGAGATCGTGAAGGAGTTCAAGTCGATCGGCACCAATAAGACGGCCATCA
TGATCGCGCATCGCTTGTCAACCATCCAGGACGCGGATGAGATTCTAGtGTTTGATGGTGGACGTGTCGTGGAACGTGGTACACACATGGAGCTGCTACG
cAACCcGAACAGCAAGTACTCGGAGATGTGGTCGCGTCAGAATCACCACAACCCACATCACGCCGTCAAGGAaGTCGAGGTC