Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-snap-gene-0.44
Orientation:
(-)
Number of Exons:
2
Description :
Cysteine protease family C01A
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.6930.69329
InsideOutsideTMhelix
1-190
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1439 bases(100 bases per row)
ATGAAGACCCCAGCTATGATGACCAACGCGTGCCTCGTGTTGAGCGTGGCGACCATGGCGACCATCCCTACTGGCGCCGACGCTCGCCCGATGCATGCTG
GCATCGACTACGAGCGCTACTTGCAGGAgAAGGACGACATCATGGACgAGTTGAACGCCTGGATGGACAAGTgGAAGGACGCAGCCCAGGTCAACGGTTG
GCTTCCaAAGGTTGAAGCTCGCAGTGCCGACGATGTCGATGAGGACCACAAGCAGCGCTTCTTCATGGCGAAGCAGCTCGTTaAgGACCTGAAGCAGAAA
AACCCGAACGCCGAGTTCTCGACTGACTCTCCATTCACGCTGCTGACGACGGACGAGTTCTCCAAGTACATCAAGAACGCGTTCATTGCGGGTGGTGGGC
GATCACTCCGTGAGGAGGCTGATACTCCAACGCCCTCGGTGAACACTCGTGACATCAACTTTAACAACTGGTGGGGTAGCTTCAACTGGCCATCGATGTG
GCGTCCATCGGCCGCTCCAGTGGCTCCGACCGCCGCTCCAGCACGACCGGTGCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGACGCGTTCAAGCTCTGGGCTCGGTACC
TGTAAGATTCTGCAGCAGATGACGCATGCGACGTTCTAA