Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-fgenesh-gene-1.19
Orientation:
(-)
Number of Exons:
1
Description :
Multiple banded antigen
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-889
NN-scoreoddsWeighted Score
0.6521.760.004
*** None ***
TypeScore
nuclear739
GO
*** None ***
*** None ***
*** None ***
Sequence
        2670 bases(100 bases per row)
ATGGACTCGTTTGGTTTCGACTTCTCGGGCAGCGAGTTCCTCGACATCGGCTCGTGGGGAgGTTCGACGCCACTCGGATCATCGCCGAGCAATGGCGGAC
TGCCATTCAGCGTCGGCACGCCCACGGGCGTCCAGAGCCTCGGCGACGAACCCTTTGCCAACCTGCCTGCTGGACATGACGACTTTAATTTCATGGACTC
GCCCAAGGCCACGACCGGTGCGTCGTCGGCTCCCGTGACGACGTCCACGGCCACCACCGCGACCACAAATGCCGGGCCTGCGAAGAGCGAGCCAGGCGAT
GACCTTGCGAACTCGTACTTCGGTGGTGAGCTTGATGGAGATGCAAGTGATGACAAGACCAAGGTCAAGACAGAAGACGCGAAGTCGGGAGGCTCACAGA
GCGCTGGTGGCAACAACGAGCAGAAGTTAAAGGACGCTAATGCTGCCGTGTCAGCATCTACAAGTGGCTCAATCTCTCAGAGCGCGTCGTCGATGGCGGA
TGCTTTCGTTATGGGTGGACCTGGTGGTGCCAGTCAGGGATTCTCCGCCAAGCCGTCGGCTTCCTCGGGGGCGACGTCAGCAGCGACCAATGTTGCGACG
TCGTCTGCGCCTGCCTCGACGAACGCGTCAGCAGCACGACCGCACATCGATGGAGCTCCTATGACAGGACCTGCAGCACCGTCACCGTCGGGACGGGTAA
GTGGCCCAATGGCCACGCAGACGCAGCAACAACAGCACCAGCAGCCTATGCAACGGTATCCACCTAATCAAATGATGATGAACCAGCCGCCAGGGCAGCC
CGGCAGCTTCGGAGGGGCGCAGCCCTATGGCATGCCTCCGCAAGGAGCCCCTATGGGCGTATCCCCTGGCCAGCCTGGTATGCAGCCCAATGCTCCGTAC
ATGCAGCAGCAGTTCCGACCGGCAACGTCGACGTACGACGAAGAGATGATGCGCGTCAAGTCGATGATGATGCAGCACCCAGATTTGATTCCACCTCCGA
TGGAAGTGCTTCGGATCTCAATGGCTCAAGCGACGATGAACCAGAACATGATGGCCAACCCGAACTACATGCAGCGCATGGGTCCACAGGGACAGATGAT
GAACCGGTTAGGAGGTGCTCCTGGGTATCCCGCCGGATATGGTGCTCCACCGAACATGATGATGCCAGGACAAGGCCAGCCGCAGATGATGGATCCACGG
ATGCGAGCCGCTCAACCACAGGTACAACAGCCTCGTGCGATGCCTGGACAGGCCCGAACACCGGGTGCGGCCACTCCAGGAACCACACCTGGAACGACGC
CAGACAATCAGACGGCATGGCAATCGGAGAACGATCTGCCACTGCGACGGAAGATGATTGGCAAGATCGTGAGTTTGTTGCAGCAGCGCAAGCCAGACGC
TCCGGCTGAGTGGATTCGTCGACTGCCAGACATGGCTCGACGACTGGAAGACTCtTTGTACCGAACTGCGAAGAACCGTGATGAGTATGGCGACTTTTCC
TCCTTGAAGACTCGTCTGCAACATCTAGCGGTCACCATGGGTGCCCGTGCTCAACACAAGGCAGGTGTCAACACTCGTCCACCGACGGGTGTTCCTGGCC
AGCCAGCGATGATGGGAGCAGCCGGTGTTCCACCGGGAGCAGTGGGTATGAACGCAGGAGGAATGCAACCAGGCATGGCACCTCAACCTCACGTAATGGG
AAACATGCCGTACGGAAACGTTCAGGGACGAATGACGCAGCAGCAAATGCTTCAACAGCAACAGCTTCAAATGCAGATGCAGAACCCTCAAATGCGACAG
CAGTTTACTCCTCAGCAGATTCAGCAGCTCCAGGCAGCCCAAATGCAGCGGCGGCAACAGCAATACCAGATGCAGCAGGCTCAGATGCAGCGACAGAACT
CTATGCAGCCTGGTCAACCTGGGCAACCTGTTCAGCCTGGCCAACCAGGGCAACCCGGACAGCCAGGCCAACAACCAGGTCAGCCGGGCCAGCCACAACA
GCAGCAACAGTTCCCAACTCCGCAGACTCTTCAGCGTCAGAACTCGCTACGTCAGCAGCAGCCAgGGCAGACTCCTCAACAGCAACAACCGCAGCAAATG
AGTCAGCAGATGAACCAACAGCGACCACAGAACCAGAACTACATGCAGCAGCCAGGTCAAGCGCAGCAACCACAACCTGGCCAGCAGCCACAACAGGGCC
AGGCCCAGAATGCAGCAGCTCAGGCTCAGCAGCAACAGAATGCACAGCTCCAGCGAAGaAACTCAATGAACGGCATGCGTCCCAGCTCAGATATGAGCgG
TCTGGGCCAAGGTCTCGGTGGCGAATCTGCAGACTTCCTGAATCTGGACTTATCACAGTCGtTCATGGGCGCAGACGATTTGTCTGTTGACGGCGGGCTT
GGTGGAGACCTCATGAAGGCCGGTGGCGACCAAATGACTGGTATGAAGCGAACATTGTCACAGACACAGCAGCAGATGGCTGCAGCGGCCAATGCAGCGG
CATTCAAGCGaAGTAAAGTGGCAGGAGGAGCCGGAGGCAGTGCGCCACGAGGCTCAAGTCCCCACTCACCTTCTCAGTCGTCTACACAGCaAAATGCTAT
GCAGAAGCCTGTGCAGGGGGCAGGTGGTGCGTCCAAGACACCGCCTATGAGCGCAGTGAATGCAAAGTAA