Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-snap-gene-0.63
Orientation:
(-)
Number of Exons:
1
Description :
Membrane protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-19
80-284
43-56
303-478
20-42
57-79
285-302
*** None ***
PositionContextScore
208GSERVKR|VV0.821
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1437 bases(100 bases per row)
ATGATCTACTACGACACCAGCAACTTTTGGGCTATCCTGCTcCGATGGCATGGCTCAGCGCTCAATGGACCTGCTCCCGTGCGTGCTTTCTGTGTAGCGC
TTTTCGCACTTCTGGTTGCTGTTGCCAACAAGTACCATCCATTTGTTGTCGCTACACGTGAGAGCACAGCTTTCGTGGACACATTGACAGTGTTCAACAC
GTTCATCGGCCTCACAGTTTCTTTTCGACTCAACTCAGCGTTCCAACAATGGCGCGCTGGTGTTGTTGCTATCAGTGCTTTGTCCGAAGCTGCTCGGGGC
ATTGTGTCGTCAGGCTGTGCGTATGTAAGTACGACTGTGCCTCACACCTGCCCAGCATCTTCCCGCAGCGACTCGAAcTCGGATGACGAGGAGCGCATCG
AAGACGCCGACAAGACCTCCCCGAATTCTCGAGGGATTCCACGTGACGTTCTAGAAAAGTGCACGTTTTTCACCGAGTTGCGGCGTCTCGTGTTCCTGTA
CATTGCGATCGTTTTTCATGACTGCCGAGGACGCGACGGTATCGATCGCATGAAGGACGCTGCCGTACTAACTGAGAGTGAGTACGACGAGCTATACGCG
TGCGGTTCAGAGCGCGTCAAGCGCGTCGTCGACAAAGAATCATTCCACGCTCTTGTTCGACGTACTCCTCATAAGCTGCGTGCGACTGTTGTAGAGCTGT
GGCTCAAGCGCCTTGTCGAAGTTGCAACACGGCGCAATCACATGACACCGGTGAATGCCAACAACTTGCAGCTCAAGATAGCTCAGCTACCAGCTCTGTA
CACGACCGTATTCAACATCGCGAACGTGCCTATCCCGTTCAACTACATGCAGTATCTGCAGTTACTGATCGTGGCGTACATGACGCTCTACACTTTCGTC
ATTGTACCACGCTCCGAGCTGTACACACCGCTTTGGGTCTTCTTGTGGGGTCTGTTCCTCTTCACTGCAGATCAAGTCGCTCAAGAAATCGAATGCCCGT
TTGGACTGGACGCAAACGACGTTGACCTCGAAGCGAGACTCCTGCAGATAGAGGAGGAACTGACGGTCATTGTGCGTAGCCAATACTACTTCGTATCGGG
TGGCAAAGCGCTGCCGAGCACGTATACCCAGCGAGGTATCTCCACAGCCCCATGGAGCACCAACACCGCTGCTTCACACCAGCACCACCACACCGGCAAG
CTACACGAGGCTGAGACGCAAAAGCCAAGCGTGAACAGCTCCTCCACGAAGCGAGAGGTGAAGGAGTCtTTTTCATTCCACCAAGGTCGTACCGAACATC
ACCACGCACCACTGGCCGCCCAAGACTCACTGCCGGAGATCAACGAGTTCACGTCCCtgATCAGCAGCCAGACGTCCGCACAGGGCTCTGCATCGGGATA
TGGGTCCCAACTCTCAATGACGTCCGGTGTTGTGTGA