Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-snap-gene-1.35
Orientation:
(+)
Number of Exons:
1
Description :
EF hand family protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
EF-hand domain11.222PS50222
EF-hand domain13.76PS50222
HmmSmart predictionP-Valprediction_id
EF-hand domain0.83SM00054
EF-hand domain9.7SM00054
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-310
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
calcium ion bindingGO:0005509IEA
*** None ***
*** None ***
Sequence
        933 bases(100 bases per row)
ATGAGCGGTGAATCAACCAACGGGAGCGACGACGCGAATGCTGCTCTCTTGAAGAAAACGAACTTGGACGAACTCAAATGGTTTCAGCATCGCTGGCTCG
ACAAGCACGGCAAGAACTCGCATCTGAAAGAGTATCGAGAGAAGATGGCGCTCCTGCGGCGGTGGTTCGAGTCACTGGATACTGATGGCTCGGGCGAGGT
CGGGCTCGATGAACTGGAAGATCCGCTCGTGTCGGTCGGGCTGGCACGGAGTCGGGACGAAGTGCAGCGCCTGATCGATCAAGTCGACAAAGATGGCACG
GGAGAGGTGACTTTCAACGAGTTCTTGAGGATGATGAACCCGGAAAAGCCCAAGAGAGCTAAGAATCGACTTCGACTGCCGCTACACAAGGCGAAaCCCA
GGACAGCAGCTCCGCCACCACCGTCGACCACAACAATAaGTGAAGAAGGAGCGACAAGCAGCGGGgATtCATCATTACGACGACCAAGCACTGCCATgAG
ACGAAGCTCGACGAAAGGGAagCCCGGCCAAGGAGGTCCCCATGGTTCAACATCCTCTAACCCGGTGGTCAAGCTCTTTGAAGATCTCCAGTCAGGCAAG
CTTGGGGACCTGGCAATTCCGTTTCCAGTTTTGATCACTGCGTACAGACGTCGCATGCTTCTGAATGCTCACATGGCTGAAGACCCAGCCGCCCGACGCC
TCGGATCAACGGTCCTTCAAGCTCTTGAATCGACCAAACGAGATGGCCTTCACAGCAATAGTGACAGCGGGCCTGGGAATCGTCGAGGTTCTGTAGTGCA
TGGTCGCACGTCTGTCTCCTCTGGAGTTTCTGCTTCCTCTCCTTCGTCGTATCTGAAGAACTACATCTCCACGGCAGAAGCTGCAGCCTCCAGCAGCTCC
AATCCACAAACCCCAACGCTCCCTCCTATCTAA