Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-snap-gene-0.41
Orientation:
(+)
Number of Exons:
2
Description :
Metalloprotease family M20D
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-729
NN-scoreoddsWeighted Score
0.5231.1370.002
*** None ***
TypeScore
nuclear348
GO
*** None ***
*** None ***
*** None ***
Sequence
        2471 bases(100 bases per row)
ATGGCGGACATGCCGACAAGTGCAGCGACAACGACGCCGGTCGTAGCCGGTGTCTCCGTGGACGCCTCGCCTAATGGAGCTAGTGTCGGTGTGAGCGGCG
TGGGTGTCGTAAGCGTGGGTTCGACGCCCGACACCAAGGGCAAGATGAAGCAGGGCGCCGGCAAGCGCCTGAACGACAAGCAGCGCGTCGAGATCATCCA
GCTCTCGGAGAACAGCAAGATCTCCAAGCGACAGCTGGCCGACAAGTACGGCGTGAGCGAGGCTGCGATTCGCAAGCTGTTGCTCAAGAAGGACGACTTC
CTGCAGCGCTACTACGACACACCGGAGGAGATTCGCGACCAGAGACTGCGGGGCAAGAGCGTTCGCTTGAGACACGAACACCTCGGCTCAATGTACGTCG
GTGGTGGCGCTGGTACGTTGTCGAACCAAGGCGGCGCCGGAGCTATGACTGCGGCCATGGTCGGGAGTCTTGGTGGCCTTGGCATGCCCATGGGCGCGGC
CGGAGTGGGGTCGTTCCCGGGGCCTAAGAGTTTGTATCCTCCAGACGACCCATGGAAGCAGGGACTGAACGTGCTCGGTGGGAAGGTGACTCCATTCATG
AAGAATTTCATGCAGAGGCCTCGAGACACATCTCTCATGGGGATGGGCGGTGCCGATGGCCTCGCTGAAGAAGCTGCGGTTGCTGCCGCTGAAGGCGCCG
GTCCAGTCGACCTCGCAGGCACTGCTGTTGACCCAGAGCAGCCATTGCCTAGCCACGTTGACTGGCTTGGGTTTGCTCGTATGCTGCGTGACATTCGTCG
CGCCTTCCACCGATACCCTGAGATCGGGTACCAGGAATTCCGCACACAGGCGTTCCTCCGTCGCTTTTGTGAGAGCTCACTGCGCATCCCAGGCAAGAAC
ATCCGCACTATGGCAAGCACGGGGCTCGTGATTGATGTGTGCTACGAGAACGCGACAATCGCTCCGAATGACAAGCGGAAGCTACCAGTGCTTGCGTTCC
GTGCCGATATGGATGCCCTGCCCATAGAAGAAATGAATGATCATCTGCCATATTGCTCCACTCAGAaGAAGACTcGTAAGGACGtgcGCAAGCGTAAGAA
gCGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTACAGCGCAAGCTGCCACGAACGACGATGTGGCAGTCGGTGACGTGACGCTCGCACCCGGT
GCACCGATCGATGTGGAAGCTGTCGAGCCGCGCGACGAAGaaaTGGACCtttCTGTGGACGTGTCGGCCGTTGCTCCACAGTCTTCCGGTGAGGCAGACG
ACAATGACGACTCGAATGTCGTCGCGCCGGCAGCGCACATGTGTGGTCACGATGGTCACATGGTCATGGTCCTCGGCCTTCTCGCGCTGGTGGTGCGTCA
GTCGCACTTGCTCCCTCGTGATACGTTTGTCCGCTTCATTTTTCAGCCAGCCGAAGAAGGCCCTGGTGGTGCTGAGCGAATGATCCAAGAGGGAGTGCTC
GAAGAAGTCGACGAGGTCTACGGTCTTCACAATGCACCGTTCCCTCTCTACAGTATTCACGTGCGCCCAGGCCCCGTGATGGCCCACGAGGTCGAGTTCT
GGATCGACATCAATGGCGTCGGTGGACATGGTTCTGCGCCGCAGAACTGTGTGGACCCGATTTTGACGGGAGCCATGGTTGTGCAGGCTCTACAGTCCAT
CGTGAGTCGCACTCTGCCTCCAACCGAGAGTGCTGTCGTGTCAGTCACTCAGTTCAACGGCGGCAACACCAACAACGTCATTCCATCGAAGGTGCACCTG
GCTGGCACGATTCGTGACTTTGATCTCGCCGTCGCCGAGAAGATCAAGCAGCGCATggAACAGATCGTGCACTCGACGTGTCTAGCAGCTGGTGCGACTG
CCCAAGTGACGTTCAAGGACAGCTACCCACCAGTCGTGAACCACCaTGAAGAGACTCGTCTCGTACAGCAAGTTGCAGTTGATACGGGTCTCTTTGTGAG
CGAAGATGGCCTGCCACTCATGGCGGCTGAGGATTTTtCTTACTtCCTGAGAGAGCGCAAGGGCTGCTTCTTCCTCCTGGgCACGAAGgAAGAGGTGGAT
GACGATAAGACCCGTGCGTTGCACTCGAACGAGTTCGACTTCAACGACAAGGCGATCCCACTTGGCATCCGAGTGTtCCTCGGCGTGCTTCAGAGCCGCC
TGCAGTGCCAGCTGATCAATGTCGAGGACTTGCAGGACTTCCAAGTCGCCATGGAGCGCATCGTCGGCTGA