Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-snap-gene-0.43
Orientation:
(+)
Number of Exons:
3
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
DNA recombination/repair protein RecA-like, ATP-binding domain11.447PS50162
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-130
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
DNA bindingGO:0003677IEA
DNA metabolic processGO:0006259IEA
*** None ***
*** None ***
Sequence
        617 bases(100 bases per row)
ATGCTGCAGCGCGCCCTCGCTCGCGATGGCGTGGATGAGAAGCCTCGCGAGGGTCTCGCGGCCAGCGGCATCCGCTCATACCGACAGCTAGTGCAGCGTC
CGCTCTGGGATGTCGCACACGCTGCAGACGTGTCTGTGGACGAAATGACGGTGCGCACTAAATGAGCTCCACTCTTTACCTTCCGAGCCTCTCATGACGA
AGATGCTAGCGGATTATCAGCAAAGTGTCCTTACGTCTTGCCCCGAAGCCGCATTCGGTATGTATTGGTGATCTATGTTCAAGGACCCATGTTGAAGTGA
GGCGTCTAGGCGTTCGAAATGTTCATGGAGTCCGTGAACCGCCCCATGACCTTGCGGACAGGCTTGCCACATATCGACTCGGCTGTGTGTGGAGGATTGC
GTTGTGGTGCGTTGCATGAGGTGAGAATGGATGAGCTGGTACATTAAAGGATCCACATAACAGCTCCCAGTTTGCGGGCGCTTCAGCAATCGGGAAGACT
CAACTGGCAATGACTATGGCGGTGAGGTGCGCCATCGACTACCCCAAGCATTCGGTCATGTACTTTGACACAGAGCGCGGCTTCAGTGCAAGGCGGTTAG
TACAGTACATCTTCTGA