Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-fgenesh-gene-0.6
Orientation:
(+)
Number of Exons:
3
Description :
Fumarylacetoacetate (FAA) hydrolase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Peptidase C1A, papain C-terminal6.5PR00705
Peptidase C1A, papain C-terminal6.5PR00705
*** None ***
HmmSmart predictionP-Valprediction_id
Peptidase C1A, papain C-terminal7.7SM00645
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-687
*** None ***
PositionContextScore
409GYIRLRR|GT0.622
*** None ***
GO
Biological ProcessGO IDPrediction Method
cysteine-type peptidase activityGO:0008234IEA
proteolysisGO:0006508IEA
*** None ***
*** None ***
Sequence
        2591 bases(100 bases per row)
ATGAAGACCCCAATCGCGATTTACGGACTGCTGGTTGCTTCTGCTGCCcTTCACAACTCCGTCACCAACGCTCGCCAGATGCATGATGGTATTGACTACC
ATCGCTATCTGAACGAGAAGGCAACGATCGAGACTGAGCTGAACGAATGGCTTCACAaGTACGAGGATGTTGGCAAGAAGAACGGATGGATTCCTCAGAC
CGAAGCACGCAGTACCGACGAAATCGAGGAAGATCGCAAGCAGCGCTTCTTCATGAGCAAGCAGCTCGTTGAAAAGCTCAAGCAAGAGCAGCCGGAGGCA
TCGTTTTCGACTGATACGCCATTCTCGCTCATGACGGAGGCAGAGTTTGCAAAGTATGTGAAGAACTCGTATATCGGCAAAGGCAGCTCCCcTTCGTCAC
TCCGAGGTtCGGACGAAGTTGCCGGTGATGCGGATGATGACAGCGAAAaGAaTGATATCGATGACGTTGAGATTGGCGACGCTGAGACTGAGACTGCTTC
cGATGACGACTCGACTCCTGTGCCTTCcAACTCGACCACAGACATGTCCAGCTTCTTGAAGAACCTGAACTTTCAGTCGTTTCAGTCGCtCGTTGAGGCA
CTTTTCAAGAaTGTGCACAGCGGAGATAAGGAGAAGCTCAAACGCCAGCTTCAACAGAACGTCGACTGGTCCACCAGCAGCTGTAATGCACCGgTGCAAA
ACCAaGGAAGCTGCGGATCTTGCTGGGCATTCGCTACtGTAGGAGCGCTTGAGACCGcGCAATGCCTTGCAAAAGGCGGCGGCCAAGTTGTCAAGTACTC
AGAGCAGCAGTTGACGAGCTGTGACCGCTCCAACTACGGTTGCAACGGCGGTGTGCCTGTGTACGCGTTCCAGTACATGCAAAGGAACGGCCTCTGCCGC
GGAAACGAGTACCCGTATGCATCTGGGTCGGGCTACGCACCATCGTGCAACGCCAACTGCCAGAAGACCAACGTGGGGATTCGCCAAGTGGGGCGAGTCA
ACGGAGAGTCTGGGCTGCTCAGCACACTTAACCGTCAGCCCGTGGTTGTTGCGGTGCATGCTGGCAACTCCGTGTGGAAGCAGTACCGCGGCGGTGTGGT
CGCATCGTGCCCAAACGCACAGGTAGATCATGCGGTGATCGCCATCGGGTACGATGCTCAGACTATCAAGATCAAGAACTCTTGGGGAACTCGCTGGGGA
GAGAACGGGTACATCCGCCTCCGTCGCGGCACTGGCGGTCGAGGTACTTGTGGTGTGCTCTCGGATATGTCGTACCCTCAAATGTAAGTGGCATACGCTC
ATTATGGGGCGCTGCAACATTATCTTCAGCCTCGCATCTACTCCTCACTTAGCCCAGTTTGTAGGGTGTCTTTGTAGCGTGATAACCGCATCCATCTGAT
CGTAATGCATTGATatGACGCCATAATAtGgCTACATTTAAGGTTGTGTGGACCACCTCAGTCTAGATTATGTGGGCGACATTATACATAATGTCGCCcA
CATAATATCTTCCAGTCCCATCTCATCAATCCTTTGACGCAAACCGTGAGGTGAGGAGCTCATGACGATCATGGCGATCGCGACGACGCGTGCGCGCCAC
TTTGTCGTGGCACAGCGGTGCATGGGTCGAGCGAACTCAACTCTGACGCGGTCTTCGTCCTATAGCGGCAGTATGGCGTTTTCCAGTACTACTAGCAGCG
ATCGCGCGACACACATTGTGCGCTTTATCGATACAACAGGCGCGACAAGATGTGGCCAACGCGTCAGCGAAGGCAGCAATGCTGTGCGTCTCATCGAGAA
CGACGACCCTCTCGGTAGTTTGAAGTTTACAGGTCAGCAGGCGACAATCCAGAAGCTTCTTGCCCcGGTTGTGCCATCACAGATCTTGTGCATCGGTCTG
AACTACCGAAAGCATGCCAAGGAGACCAACATGCCCGAGCCAAAGACGCCTGTGCTCTTCACCAAGGGTCTGAACACGCTGCAGAACCCTAATGATCCTG
TTGTGATTCCTCGCATCGCATCGGACCCGCCAGAGGTCGATTACGAGTGTGAGCTCGCGGTCATTCTTAAGGAAAGTTGCAAGAACGTCAGTGTCCAGGA
TGCGCTTAAATACGTCGGTGGATACACGTGTGCGAATGACATTTCAGCTCGCCGTTGGCAGGGGAAAATCGGCGGTGGTCAGTGGTGTCGCTCCAAGAGT
TTTGACACGTTCTGCCCGATCGGTCCTGTGCTCGTGACTCCAGAGATCATCCCGGACCCACAGACTCTCGAGATTGGAACGTATCTGAACGGCAAGTGCA
TGCAGAAGTCATCGACTGGTGATATGATCTTCCCTGTTGCTGAGCTCATTAGCCAGCTCTCTCAAGACACGACTCTCCCACGTGGCACCCTAATCATTAC
GGGTACTCCAGAGGTATAGCGTCGTGCGCTTCTCGTTCTACCTCATCGGCAACTAACCACTCTCTCTCTCGCAGGGTGTCGGCTTCACGCGCAGCCCACC
AGTGTATCTGAAGCCGGGCGATGTCATGGAGATCGACATCGAACGCATCGGGAAGCTCGTGAACCCAGTCATGGCCGCATCGGCCTTGTAG