Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-snap-gene-1.27
Orientation:
(+)
Number of Exons:
4
Description :
Titin isoform N2-B
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Filamin/ABP280 repeat-like9.527PS50194
Filamin/ABP280 repeat-like19.226PS50194
Filamin/ABP280 repeat-like13.287PS50194
Filamin/ABP280 repeat-like16.78PS50194
Filamin/ABP280 repeat-like8.684PS50194
Filamin/ABP280 repeat-like9.979PS50194
HmmSmart predictionP-Valprediction_id
Na-Ca exchanger/integrin-beta40.0014SM00237
PA149.3SM00758
Filamin/ABP280 repeat1.9SM00557
Filamin/ABP280 repeat8.7SM00557
Filamin/ABP280 repeat6.2SM00557
PA146.5SM00758
Filamin/ABP280 repeat0.0017SM00557
PA140.013SM00758
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Filamin/ABP280 repeat-likeIPR017868
PA14IPR011658
Y-scoreD-scoreY-pos
0.6790.81623
InsideOutsideTMhelix
1-1884
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
integral component of membraneGO:0016021IEA
KO ID
K04437
K04437
K04437
K04437
*** None ***
Sequence
        5840 bases(100 bases per row)
ATGAcGCCCAATGGAATGCTCCGACCGCTGCTCTTGGTGATCGCCCTGTGGCTCCCGTGCAGCTCGTTCCGCATCTTATCGTCGTCGAATGACTCAGCCG
CCTCTGTGCGTGCTGtCTTTGAGCCGTATGTGAAAGGCGGCGTTGGATACTATGGCGATCCAGCCAACCCCGACCCAGAACGCGTCAATGAAGGCGGGCC
ATTCTCGCCTGACAAGCCGCGCGTGTATCTCTATGGGACACCGAAGCGTACGTAGCCTGTGCTTTCACTAGAGCGGGGGTAGTTGACGAGACTCGTGCGT
GGCGGACCAGAAAACTGCCCAGGGATGGTCGGCCCGGTGAACGAGGAAGAGTATTATTGCCATGGCCGCGAGTATGGATACTGCGACCGTCGCAACGGCC
TCTGTATTTGCAACCAAGGCTACACGGGGCTCGATTGCACAGACTGCAAGCCGTCGTATTTCAAGAAGGGCAACTTGTGTTACGCCAAGAGTACGTGCAT
TGCTCATCACGCGGCTGAGGAACTGGTACTGATTCATCCATCGTAGAAAGCTGTCCCAAGGACTGCTCCCGCGCTGGCGTGTGCAACTACGAGACTGGTG
TCTGCACCTGTTCGCTTGGTCGCTCAGGCATTGACTGTGCTCAAGTCGTATGTAGTTTCGATGCCGAGTGTACGAGTTGTACCCGATCGACaTGTCTAAG
CTGTATCgAAGGATACTACGTCGATCCGTCGACACAATCCTGCAGTAAGTGGGCTTTCTTTCGTCGGCTGCTGGCGACTGCATGTtGATgTACGGGTTAT
TGTTGAGCAGTCTCCTGCAAGAGATATGACCCACGCTGTTTAGTTTGTGATGCTATTCGATGTATCCAATGCTCAGATCCAATCCTCAACTCTGTGCGCC
GTAGTGGGGCTCGGAAAATTGACGCTGCTCTGCCTTTTGATGAGCGGAATCGCGAGTTCTCGTTCAAGTTTTCGTATGGCAGCCAGGATCCACGAGTGTT
CGATGAGGCCGAGACATTCTTCCTTCTCTCTTCGACGGCGCTCAACTATCTCAATGATAGTAGCGTGAGCTGCACACAGGGCCAAAACCGCGACGCCTCA
TGGTCATGCCAGCCAAACCCAGTGAGTCATCGCGTATGTGGTCATGCTGGCGTATTCTCCTTCACGTCACCAATATATGCAGTCCCCGAGACCGCACAGA
ATATCACGCTCACAGTGCAGCGTAGTGGGGGTGgCATGGGACAAGCAAGCGTAGCGTATGACATTCAACACGTGACAACAGATGGAAgCGATGTGTCAGC
TACTGCCTACTACACGACGTCTCAAGTGCTTACGTTTCCCGAGGGCgTTGTGAATAAGTCATTTCTCCTCACTATTCACGACGATCACGTTGTTGAGAAG
GATGAAACcTTTCGAGTTGTATtACGAACTCCAAGCGACGGAAGCTACCTAGGCAACCAaCGAGAGGCTTTtGTCACAATAATCGACGACGACTCACCGA
TGACGGACGCGGGATTGACGTATGTCGTACCTGGAAGCGGTACTACGCTTCAAAAAaGaGGATTCGCCGGCGACTCGCTGACATTCCAGATCCAGACtGT
TTtGGGtgATGGCACTGCAAAGAaGACTGGGGGTGACTTGCTATTGATGGAGTCGTACGTCTCCGATGAGAGCATCGACGAGATAGCTACTGACTTTtCG
TTGTATCGGCCGAGAATGACCGGACAGCTCACGGATCACAGCAATGGGACTTACTCTGTTACGTGGCAGCGTAAGCATATTGGGAACTACACAGTGGTTG
TGTATTTGATGTTTGCGGGtGGTTTGCGTGGCGATTACTACGCCGATGCGTGGCTGACCGGGCTCCCGGTTGTATCACGGATTGACCGCCGACTCAACTT
CACTTGGAATACTGGCCCGCTGTTTCCAGGGGGAAGCGACTATGTCGCGGTCCGATGGAGTGGCCGGTTGAAGCCGAAAGCCACAGGCGATACGACATTT
TATATCACATGCGATGACCACGTCCGCCTTTGGATTGGAGATTGGCTCTTGATTGATCGATGGAGTCAaGAAAACGACGATGGTGTGCAAGTTCTAGCGA
CGATGTACATGGACAGCTCGCTCTTTTACCCCATACAAGTTGAGTATCGCGACTTAGTCGATGATGCACGAATCTCGCTAAGCTGGAGTGGCCCTTCTTT
CACGAAAGAGGTCATACCCGGCTCCTCGTTGTACTCTGTCCAACATATTCAAGGGAGTCCACTCAATGGCGTGAGAATCCTTCCTGTGCAAACTAGCAGT
GTCACAACCAGCTACCTtCAAGGAaCGTTtGCCACTGTTGCTGGAGTGCCGTTAACTTTGAAGCTGTATCCCGTTGATGTTTTtGGgAATCCAAGAAAAG
GGTTTGATGCCAAGGTTGATGTATACGCAGCTCAGCTCTCTTTGGTGAGTGATTTGAGCCTTGGCGGTCTCGGCAGTAAAGTCGTAAGTTGTGAAGTTAC
GTGGGGCGGCTCGTTTGAGCCGTGGTTTATTATAACGTGCGTTCCGTTCTTTTCGGGATCCCACAACCTTCAAATCTACCTGAACAACGCCCTCATCAAT
GGAAGTCCGTTTGCCGTGGACGTTTCACCCAACAACATGAATCCAGCACGCTCGATTCTATCTGGAGCTGGTCTCACATTAGGCCGCATTGCTGGGGTTC
CGACAAGTGTGAATCTCGATAGCCGTGATCTCCATAACAATCGAATCTACTCGAGTTCTTCGCGTCTGAACTTGGAGTTACGCGCCATCCATACGACCAT
GGCTGGTAATGTGGCTGCAGGAATGGTCAAGGATAACCAGGATGGTACGTACACATTCACGTACACGCCTCGCTTTGTCGGCTCGTACCTCGTCCACATA
ACTCAGAACGGCATACATATCCACAACTCGCCCTACACTATTACTGTTGTTCCAAACGCTGCATTTGGTCCAACAAGTGTTGCCACAGGCACCGGATTGA
GCGTCGCATCAACGAATATCCAGTCATCTTTCCAACTTCAGTCTCGTGACTTGAACAGCAACGACCTTACGACGGGGGGAgCAACGTaCCAAGCAATTAT
TGAGCATCCAACAAAAGGCAACGTCACAGGAACTTGTTCCGATCTTCTCAGCAGCAAGTACTCATGCACTTACACACCCCAATACGTCGGCCTGTCCAGA
ATCCATGTCGGCCTGGTCACAGGCAACATCTTCGTCCCAATCATGGACTCGCCTTTCCGTATCGACGTCATTTCTGGTCCAGCTCTCGGCTCGAAGTCAC
GTGCGACGGGCAgTGGGCTCGTCACATCTATTGCTGGTCAAACAGCCAACTTTGATGTTCTCATTCGAGACTATTTTGACAATGAGAAGCTTAACGCCGG
AAGTGAGGCGATTGCAGTGTCGTTCgTTGGGCTATCACCATCAACTTCAACCGTCGCTGCCATCAACAATGCTCTCCGTATTGTGTACGCCGGTGGCGGC
GTTTACAACGTCTCGTATACGCTTCAAAAGAAaGGCGCATACAAGATTCTGGTGACAGTCGACAGCGTTGCGATCGTCGGCAGTCCATTCTCCATGTACA
CATACCCGGCACCTGCATCCTACTCGAAAACGACAATCGATATGCTCGTGCCATCCTGGGATGGCTCAACTCCTATGGCCTTCGCCACAGGATCTCCCAT
CATCACTCGCATAACTTCGCGCGACGAGTGGGGgAACGTCCTCGAATCAGGAGGATACTTCTTTGAGTTTGATCGAGCCTTTACCAACAGTACCCTCTTC
AGCCCTGTCCGCTTTGACGATGAGAAGAACGGTAGTTATTTATTCGAGTTCACTCCTCGTATCGCACAGACTTACCCTTTGGGCCAACGTATCATGTACC
CTCGAGGGCTGAACGCAACATTCTACCCCACACCTGATCTTTCTGGTACGgCAAAGCTTCAGCGTGTCGACCCATCTATCAATTTTACCTTCGGCGATTT
TGCTCCGACGTTCACGGACGACCTGGATACCTTCAGCGTCAGCTGGAAAGGGTTTTTGCGACCAAAGTTCAGTGAAGTGTATACATTCCATGTGACTATC
AGCGgAGGGgCGAAGCTACGCATCAATGACCTCTTGATGTTTGAGTCGCTCTGGCCAAACTCCACGCGGACGCACTCCATGGAGAAGCTGCTGGTCGTTG
GGAACCGTCTTGTGCCCATCGAATTGAACTTTTCGAAGCCACAACTGCTCCGGCATCCGGCGATCCTGTTGGAATGGGAGAGTATGACTCAGACGCGAGA
AGTGATTCCTCCGgaCTGCTTTTTCACAGGgTGGTTGTTCGTCAACAACGTTCCTCCGCTACGCATCGTACCAGGAGATGCTTACAGCCCCGCGTTCACA
ACTGAATTTCCAGTCAGCAGCCTGTCCGTTCCTGGGTTTGTGACGGCCGTCGCGGGACAGAACTTTGAGTTTTACGTAACAGCCAGAGATGAGTTCACGA
ACATTCGATTGGAAGGTGGAGACCGCATCTCGGTGCTCTTTCCAGAACTTTCAGGCACCAGTGATATCACTCCTGTCGTCGTTGACTATGGAAaCGCAAa
GTACAAAGTCACAATCGCGCCGAAGGTGCGCGGTGACTTTGACATGATCATTGCAGCCACTCGCTTGGCCGTTGATATCCACCCTGAGCTTGGCAAGACT
TCATTGGTCACTCAACTTCAGCCGTTCAACATCAAGCAGAGTCCATTCAGACTCCGCGTCATCCCTAACAAGCCGCTGGCGACTACCTCCACGCTCCTTG
GACCAGGTATCGTATCCGCCATTGCTGGAATACCGTCCAGCTTCACCGTTGAGCTGAGGGATGTGCACTCCAACCTCGTTCAAGATGTCGTTGAGGCTGA
GGATGTGATCGTCAGGCTACGACTCTTGAGTAATCCAGAAGTCGCCTTGAATGCAGCGTTTACCGGCGCTCAAAATGGCATTCTTCCCGTGACTTACACA
GCCACTGTGACGGGAATGTATGAGATCGTTCTTGCTGTTCTTGACGGTGTGCTCGTACAGAAGCTTACAACGCTGCGCGTGTATCCGAACGTTGCGTCGG
CCCTCACTTCGAGTGCCTCAGGCTCCGGACTTGGACCCCAGGTGACTGCCAACACACAGCAGTCCTACCAAATCGACCTTCGCGATTATTATCAGAATCC
TCTCGAGACTGGTGGCGATGGTCTCGCCATCACGCTCCGTGGCCCTGCAACCGTTTACGCCGACGCTGTCGACCTACAGAACGGACGCTACATCGTGAAC
TACCAACTGCCTCTCCCGGGTGTGTACGAGCTGCAGAGCATCCTCGCCAACCAAGGGCGTGGACTCGTTGGATACTACTTCGAGAACACGCGATTCGCTT
GGATCGGCCTTGGGCAGACGACCCACTGGGTCGACCCAGTGCTCGACTTCGACTGGAACGCGAACCAAaCCATGCGCAACTACCCGCGTGTCCAATGgCG
GGGCTTCTTACGCCCGCGCTTCACAGAAaCGTACACACTGCGGTTGAGCGTCTTCCCCGCTGGTGCTGTGTACGTCGACAACGTGCCGATCATTGACGCT
CTGAACCGCAACGAGTTAGCGGACGCTTCCGCGACGGTCTTCGAGGGCACGGTGCAGCTCGTGGCCGACCGCCTGCACCGCCTCGTCGTTGAGTACCGCA
GCACGTCGAGCCGCGAGGTCGCGGGCTTCCTGCAGCTGCAGTGGCGCAGCGACCGCCAGCGACCGCAGGTCATCCCCACGGGCGCATTGCTGCCTGATGG
TCAAGAGCTTCAACCTCGGTATCAGATCACGGCCGTGTGA