Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-fgenesh-gene-1.21
Orientation:
(-)
Number of Exons:
6
Description :
Endonuclease/exonuclease/phosphatase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-673
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2722 bases(100 bases per row)
ATGACGCCgGCGACAGTcGTTCCAGCTGACTTCACGGCAATGGGTGTTgGGGAGTcCGCTCTCAAGGTCATGAGTTTCAACTTGAGAACATCAAATGCCA
GGGATCCATGCCCAGCAGGTTGTTGGGCACAGCGCAAGGCCCGAGCGCAGAAGCTGCTGCAGACTCATGCTCCTGACTTTGTCGGCACACAAGAAGGCGC
TCCAGACCAGATCGCTGACATGCAGTCTTTCGGCTACGCCATGTTTGGCGAGTGTGCTGGTCCCTGTGCCGAGaACGAACGCGATGGCATCTTCTATCGA
GGGGACAAGTGGGAACTCGTCGCTGGGCAAACGTTTGCTTTGGTACGCCTTGACTAATTGCTTTTCTTCTCACTATATGCCTCCTGACCCACGTGATTGT
GATCCACAGAGCGATACGCCTGATGTCGTACCATCGAATACGTGGAATCTAGAGTACCTGCGGACGGGTGTACTCGCTCGCTTCCGCTCCAAGGCAGGCG
CAGGGACTGTGTGTATGCTCAACACACACTACGATATCTCTCGCGGCCAAGAGCAGTCTTCAGTGCTAGTCACCGAGCGAATGGCCTCCTTCTGCCAGCC
CGAAGACACTGTTGTCATGACGGGTGACCTCAACACCCCGCCTGGCACACCAGCCATCCAGTTCCtcGAGAACAAGGCCTCTATCCGCGGCAAGACGAAC
CAGATTCCCATGTACGAGACGCTTACgGCAgCgGGGGCAgGCGGGCCAACGTGGGTCGGCCCAAGCTTCgGCACCCAAGTCGTCGGCAGCAAAATCGACT
ACAtCTTTGCACgCCGTGACACACACACATGCtTGCAGCgGGGCGAGATCCTCACAGACGCGATTGACGGCTACACGAGCTCAGACCACGCCGTCGTCAT
GTCTTCATTCTGCATGGGGGCTTCGTGTTCTGGATGTGTGTAGGTAGACTCTATaGAAGGCATCTAATGGTGCTGTACAGTGTaTGAGTATGTGTTGCAA
CTTCGTATCCACTTGAATCTTGGCCTTGTTGCACAGAACGAGAGGAGCtTcCCGATTCGAACGACGTGTACTCAGATGGCTTGCTTACTGCAAGCAAGCA
CCATGACAGGCACGACTAAACCAGCATGTCTCCAGACTCTGTGGATAGTCAAACGGCAGACTCGACGCGTCAGTCTTGGATGCCGCAACACATTGGCATT
TCTCAAATTTCCAGCTCCAGTTCCgTGCCTCTTACAGTACAAATGATCAGCAAGCTAGTAGCCTTCGCAGCTTTAGTGAGCTCTGCCGTCGCTCTGGCCa
ATGCTGATGCTGTCAAGGTGATGAGTTTCAACGTCCGAACGTCGGTCGCCAAGGACCCATGTCCTGCTGGCTGCTgGGATGaACGCAAGCTTCGCGTCGA
GAAGCTGCTTCGCCGTCATGAGCCCGACTTCGTTGGCACGCAGGAGACAGCGCCAGACCAGACGGaCTTCATCGCGTCCCTCGGGTACGCCTGGACtGGT
GaATGCGCGGGCAACTGCCAGTGGGACGAACGCGACGCCATCTTCTACAACGCGTCCAAGTGGCTCATGCTTGACGGGTACACGTTCGCTTTGGTAATGC
ATCTCCTTCATAGCGCAGTGCGTCTGCAATGATACTAACCGACTCGATGtTGTTGGCAGAGCGATACGCCCGAGATCGTGCCGTcCAACACGTGGAACCT
CGAGTATCTCCGTGCTGCCGTGTTAGCGCgGTTCATCAGCAGGGAACCGCAGACACCGTGTGCATGCTCAACACACACTACGATATCACACGCGGCCAGA
ACCAGTCGTCTGTGCTCGTgGCTGACCGCATCGCGTCGtTCTGTCAGCCCGAAGACACCGTTGTGATGACCGGTGACCTGaACACCCTGCCAGCGTCGGC
ACCAGTGCGATACCTGCAgGGCGAGCTGTCGATCaATGGCTCGATGACGCCCATcCCCATGTACGAGACGCTTACGGCCGCAGGCGCTgGTGGTCCGACG
TGGATCGGCAGCGCGtTCAACACCACGCTCACAGGTGGCaAGATCGACTACATCtTCGCGCGTCGCGACGCCCACACGTGTCTGCAGCGAGGCGACGTGC
TGCTCGACGCCTTTGACGGGTACACGAGCTCGGACCACGCGGTGGTGATGGCGTCGTTCTGCATTGGTGGCGAGTGtcGAGACTGCATGGTGTAAGTCAA
ATAGAGATGCTGTGACGTGTGAGCATGACGTAGTTGCAGTTGGGATGCGAATGAGTGACATTCGGATACTGACATGATGCAGAAGCCCATGGTTGCGTGG
TGCCACCCGACAATGCAGGAGCTCACAGAGTGTGTGGGCGTGGGCGCTGTTGGACAGTGGCCTCTGACAGTGAGTCCAGTACTAGTATGGTCTTGTAGTA
CTAGCGGGCGCCATGTCGTGCCATGCTACGGTTATGGACTATCTTATCTATGACTTGAAAGGAGAGTGATCCATGAAGCAAGTGCCCTTCATGCGTCTTC
CTATGATTCGCCAAAATCTGCATTCTTCATTGTTCATAGCCAGGCTGGCTATCAGGCTCCATCACCGTCAcCCTACAGGGTGACCAGGAGCGGAGTGTCG
TGGAGTGCTTTGCAAAGGAGGTGGACACGCTGCTTTACCTGACCAAGAGTCAACTACAGCTCCCGCTCGCCGCACGTGTGATACAAGCGAACGCGCTCGC
GCAAGATGTCGAGaAACTGCAC