Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-fgenesh-gene-0.5
Orientation:
(+)
Number of Exons:
1
Description :
ATP-binding Cassette (ABC) Superfamily
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.7780.8321
InsideOutsideTMhelix
214-214
1-190
191-213
NN-scoreoddsWeighted Score
0.7511.4440.003
*** None ***
TypeScore
endoplasmic reticulum444
GO
*** None ***
*** None ***
*** None ***
Sequence
        645 bases(100 bases per row)
ATGTCAAGCCTCCTtGCCGTCTGTCTCGTGGTGGTAAATGTGCTCTTTAGCGCACACGCCAAACGTGAGTTTGTCGCTCGCATCCCCAACGGGAACAACG
TCGGACGCGTAGAGGCTCTTGGACACGTCAGGTGGGACGGCAGTGGGCCGCTCAACGACTTCGGCAAGGCCTTTGCTGCAGCAGGATATGAGTGGACGCT
CTCACTGTGCAAGGGAGACGCCGACGGCGACGGTCAGaCGAACGGAGAAGAACTGGGTGATCCATGCTGCCTCTGGGTGCGTGGTGCGGGCGTTTTGCCT
CTCATCACAGACATCTTGTCGCATCCGGGAGACTTCGGATCGAAACTGAATGCCTCGGACCTGCAAATGCGTCAACTTGTGTGTCAGGCGCTGGAGCGTG
TCACGACCAAGATGCCAGCAGTCGTATTCTACGAGGGATCCTCATGGTCACCCTCCGCTCAAAATTCCAACTCTTCCAGTGGCTCATCAGCGGACCCAGA
TGACTGGGGACTCAAGACTTCGCACCCGCTCACCCCTCCACAACCGGAGACGTCTTCTGCACGTACCGCTTTTCCGCAGTGGGGATCGTTTGTCGTCTGC
CTTACGCTTGTCACCACCTTCGCGACTTGCATTCTGCTTCACTAG