Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-fgenesh-gene-0.4
Orientation:
(+)
Number of Exons:
1
Description :
ATP-binding Cassette (ABC) Superfamily
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.620.70524
InsideOutsideTMhelix
1-226
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        681 bases(100 bases per row)
ATGAaCCTCCGCTGCTTCTCTCTGCTTGTGTGCGGTGCCACGGCACTGCTCGCTACCTCCACGGACGCGTATCCACGTCTCGCCAAGGCCATTCCGAATG
GCAACGGCGTCGAGGGCGTCACGGCCGTGGGCCACGCCGACCCGAACTCGGGTGGCAAGGAACTCAACGCGTTCGGCAAGGCCTTCAAGGCCGCCGGTAA
CACCTGGACGACCGAGGTGTGTAAGGCCGACTCGGACGGCGATGGACAGACCAACGGCGAGGAGCTCGGCGACCCGTGCTGCACGTGGAAGGCGGGTGGC
ACGCCCGCCGTGGCCACGGGCGCTACGGACCCAGGTGTCGCCACGTCCAAGCTTGACGCCGCCGCGCTCGCGTCGGCGCGAGCGCTCTGCAAGTCGAGTG
GCGCGTCTGCTGGCACGCCAGGCACCGTCAagCCTGCGGACAACGCTGCCGCGTCCGGCTCGAGCGAGTACGAGTGGGTGCCAATTGAGAGCGTGAAGAA
CTCGACGTCCGCATCGACGTCCGAGTCCACCCCATCGGCGACCAAGTCCAGCTCGACGCCATCCAGCTCGCCCACCACTACGACCTCGGCGGCTGTCTCG
ACTTTCtCGGTGGCGTCGCTCTCGGCCTCGGCCGCCATTGTCGGTGCCACCACCGTGCTGTCGCTCGCTGGGGCTCTTTAA