Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-snap-gene-1.28
Orientation:
(+)
Number of Exons:
1
Description :
U11/U12 small nuclear ribonucleoprotein 35 kDa protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
RNA recognition motif domain18.103PS50102
HmmSmart predictionP-Valprediction_id
RNA recognition motif domain3.3SM00360
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-230
NN-scoreoddsWeighted Score
0.5241.2510.003
PositionContextScore
24RRLRARR|SR0.732
26LRARRSR|SR0.56
35SRSQIPR|SV0.569
TypeScore
nuclear913
GO
Biological ProcessGO IDPrediction Method
nucleic acid bindingGO:0003676IEA
*** None ***
*** None ***
Sequence
        693 bases(100 bases per row)
ATGGATGGAAGGTCGCGGAGTCGGAGTCGCTCCAAAGAGCGCCGTGAGGACAGGCGGCTGCGCGCCAGACGCAGTCGCAGTCGCAGTCGCAGCCAGATCC
CTAGGAGCGTAAGTGCGGAGGAGCCGCGGCGCCGCGAGAGTCGCAGTCCACGACGGAGAAAACAGGCCGTCGCGCGACCGCGAACCGACAAGCGGGCGCA
TTGGTTTGCCAAAGAGTACGACCCCATTCAAGTCGGCAGCATCGATGGTACTGATACTGTGGCGCATGACAAGGCGCTGGTGCGCGCTCAGCGTGCGAGC
TTTGACGCGTCTCGGGACCCGCTGATTCAAGGCAACCCATATGCCACGCTGTTTGTTGGGCGATTGAATTACGCGACCACTGAAGAGACGCTGCAGCGCA
TCTTCCAGCAGTACGGTCGGATCGCCCGCGTCCGACTCGTCCGCGATCGCACGACGCACCACTCCAAGGGCTATGCATTCATTGAGTTTGAAGAGGAGCG
AGCGTTCCGGGACGCGTACCACTCGGCCCATCGCCAGCAGATCGACGGGCACACGATCCTCGTCGACTTTGAACGCGGgCGTGTCATGCCTGGCTGGAAG
CCGCGGCGCCTGGGCGGTGGCCTGGgCGgCAAGAaGGAGTCTGGTCAGCTGCGCTTTGGTGGACGcGACCGTCCGTTCAaGCCGCcGCGTTAA