Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-snap-gene-0.45
Orientation:
(-)
Number of Exons:
1
Description :
Adenylate cyclase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Adenylyl cyclase class-3/4/guanylyl cyclase8.756PS50125
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
32-50
128-154
210-229
280-552
1-9
74-104
173-186
253-256
10-31
51-73
105-127
155-172
187-209
230-252
257-279
*** None ***
PositionContextScore
229LHQRIKR|LV0.575
*** None ***
GO
*** None ***
KO ID
K01768
K01768
*** None ***
Sequence
        1659 bases(100 bases per row)
ATGGACCACTCGGCGTTCAACTGGACGGTCGCATATGTCGTGGCGCTGTCCATAGCAATGGTCGGCACGTTCACCACGCTGCTACTGGCGTTCCGTCAAT
TGAACGTCACGGAGTCGGCAGTGCAATATGTGATGTATTCTTTGTGCCGCGCCTACTTCATCTACTCGGCCTTCCGATGGACATTCTACGTTGGAGTACT
CTGCAACTGGAACGGTGTGCGCGATTACTTGGACGGTTTTGACAACGGACAAATGGTTGGCGTGCGCATCGTGTATGCTGAAGCGACGAAAGGAGGAACA
AAGGGAATGGTTTTACTCGTCGCGTTTCTTGGTGACGTCGCGCTGCTGTGTACAACATTTTGGATCATCACGATGGCTTTTGAAATGACTCGGCTGATCG
CGAAAAGTaTGGACCGAGGCGCTGAAGAAGAACGCAAAGCGATGCGCTACCACAATCTACGCACTTACGGTTCAGCTCTTCtCTTTTCtTCCCTcATGCT
CGGCTCTGCTTGGCTATGCCCAGGTCAGGAAGCCGTTATTCAGCATGTCGCTTTTGGTTTCCAGCTaCTCTCAGTGTgGTTTTCTTTTGTATACCCGTTG
ATGTGTACAATTCACCTGTCTgTaCGGAAgCGGATGGCCTCAGTTGTCAACCCTTACTCACTCATGCTTCACCAACGTATCAAGCGTCTCGTGATCGTTT
ACTGCGTGCTCGTGTTCCCAGCATGTCTTGTTGAAACGATCCTTCTATTTAACGCCAGAATCCCCGACTTGTGGATCGGTATTTCCCAGTTGCTCTATTA
TTTTTCAGGTGCTGGAACAGCTTTTGTGATGGGAGTAAGCGTTACGTGTTGCTACCGAGCACTGCAGCCCATTATGCCAACATCTGTGTACGAACACTTA
CTGGAGAACGGCTACTTTCCCGAGGAAGTCTTGTATGACCCGAATATGATTGTTGAGCCTCCGACAGAGAGACCCATTTTCGTTTGCACCGACATTGAAG
GCTCAACTGCACTGTGGGCGTCTTCTCCAGATGCGATGTCTGAAGCACAGTCGCTTCATGATGATTTGCTTCGAGGAGAGCTTATCCGTTACCGGGGATA
CGAAATCACGACTGTTGGGGATGCCTTTCAACTCGCTTTTCACGATGTATCAGATGCAATTGCTTGGTGCATTCATGTCCAAGAAAAGCTCCTCAAGGTT
TACTGGCCCCCTGAACTTTCGAAGAAGGACTCATCGGAGCGAGTTTACGACATTTGGGGGCGTCTTGTATTTAATGGACTTCGTGTGCGTATGGCAATTC
ATGACGGTGATGACAAGCTTATATGCTCGAAACACCCAACGACAGGCAAGATGACATATCTTGGTGTGAGCGAAATCATTGCCCGCGAAATGGGTGATTT
GGGCCGCgGCGGCCAAATATTTATTAGTGATTCAGCTTTGCGAATCTACCTCGAGCAAGAGAAACTTCAGATGCAGCATAGAGTACACGAGACATTTCAC
ACCGAGCGACAAGAGGAGCCATTTCGAAGCCCCGAGATGCAGATCTCTTTTCCAGTTCACCAGATCATTGCGAAGTCAATGGGGGATCGCTTCCAGAGAG
AACAAGAATGTCGTCCCGATCTCATTGCTGCTCGGATGATTATCATGCGGGGTCACTAG