Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-snap-gene-0.38
Orientation:
(+)
Number of Exons:
4
Description :
Isoform B of Splicing factor U2AF 65 kDa subunit
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
RNA recognition motif domain10.087PS50102
HmmSmart predictionP-Valprediction_id
RNA recognition motif domain, eukaryote1.2SM00361
RNA recognition motif domain, eukaryote3.5SM00361
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-497
*** None ***
PositionContextScore
152KKSRKRR|SK0.802
TypeScore
cytoplasmic522
GO
Biological ProcessGO IDPrediction Method
nucleic acid bindingGO:0003676IEA
*** None ***
*** None ***
Sequence
        1645 bases(100 bases per row)
ACCcTAAGGGATTtGAATGCGCATCAAAAGAGCACTCCGAACGAGCAAGCGAAGCCAAAGAGGTGGCGAAAGCGGCACCAGCGAGGTCCTGAAGTCACAA
GTGAGAGCGGTGAGTGGCGACTGAGTGTGCGCCATGCAGTCGAAGCCAACGAGCTCGAAGATGAGGATGAAATCAGCGAGCTGGTTGCTGAGTTCACGGA
AGAGTATGAACAGTTTGGTGTGTTGAAAGCGCTGGAGATCAATCGATCGACAGCCGAGCTGACGGTCATCTATCATGACGCCGCGGCGGCTCGATCGGCG
GTCCTGGCCAAGCATGggAAAATGTATGGAGGTCGTGTTTTAGCTGTGGAGATTCAGACGCCCCACGAAAAACGAGTTGAGGAGAAGGACAAGGTGCACA
CGGACCAAGCAGAGACCTCTGCACCTGTGAAGGAGAAAAAGaGCAGAAAACGCCGAAGTAAAATCAAGAATGCAGTCCTCAGGGCTAGAGAGAAGGCAGG
TGCTGATGTTGACGGCAGTAGTCGAAGCGCTGCTTTTATTGTTCGAAATATGGTAGAGCCTAACGAGGTGGAGGATGAGGACGAATACGAAGAAGTGCTC
GAAGAGATTAAGGAGACGCTCGCAAAGTTTGGGGACGCTGTGTCTGTCACCATTACACGAGATAATGTAAGTGTGGATCATGCAACTCAGATCGGAGATG
TTGCGGTCACGTTTACGAGAGTCGAAGATGCACAAGCGGCATTTGCAGGACTGGACGGAATGACGTACGGCGGTCGTAGTTTGCGATGCAATTGGCTCAT
CCAGCCAGTGAACGGGAGTATCGTCAGCGTGGAAGGAATGTTCGAAACGGAAGAGCTCGAAGATGACGATGAGTTTGCTGATGTCCAGGAAGAAGTGGAG
GCATTTATTGCGAGGAGTGAAATTGGTGCTCGGTCAGTAGAGCTGTGTCGGTCGACTGGCACAGTCACGCTTTCATTCCAGAATGCCACTGATGCGGCAG
CAGCTGCTGTCCAACTTCGTGCGAAATTGTACGGAGGGCGCTCACTTGATGTGACGATGGTGGAACCAGTGGTTCCTGCGACTGACACGCTACATCCTCG
TCCAGGGCTACAACCTGAAGAAAATGGCAGCGTTCGATTACCCGACGAGATACAGGAATTGTTGGTAGCGCTACTTCAGCGACTCGCTGCACTGCAGGTA
GGCTGAACTGGAGGATTGGAGACTTCTTCCAACTGATTATAACGCGATTCGCAGGAACGAGCTCATGCCCAAAATCCACTTTATGACAAGCGCTCACGGC
GGCTTGTGCTCGGTCTACACGAAGTACGTAGGGGGCTAGTTGCTCGTAAAaTCAAGTTGGTGATTGTCGCCCAAGAGTTGGATGCATGTGAGGTGGTCGA
TGACAAACTAAACGAAATCCTCAGTATTGCGGCCCGCGAAGAAGTGCCTGTAATTCATGGgCTTACTCGGTATGAACGCGTCCGGTGTGATTCTAACGTG
GgTGACTGACCCCGATTtATTAGGAGGAAGCTTGGCCGTGTGTTGAAGAAACATGCTCGAGTGAGTTGTGTGGGTATCTATTCTGTAGATGGAGCCAACG
AACTCTTCAAACGGTTACTTGAAGAGCACAAATGCAAAGGATTAA