Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-snap-gene-0.59
Orientation:
(-)
Number of Exons:
2
Description :
DEAD/DEAH box RNA helicase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
RNA helicase, DEAD-box type, Q motif10.449PS51195
Helicase, superfamily 1/2, ATP-binding domain34.414PS51192
Helicase, C-terminal13.999PS51194
HmmSmart predictionP-Valprediction_id
Helicase, superfamily 1/2, ATP-binding domain1.8SM00487
Helicase, C-terminal5.2SM00490
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
RNA helicase, DEAD-box type, Q motifIPR014014
Helicase, superfamily 1/2, ATP-binding domainIPR014001
*** None ***
InsideOutsideTMhelix
1-857
*** None ***
PositionContextScore
717WDTRKKK|FV0.611
820EEKRKAR|SR0.584
TypeScore
nuclear391
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
nucleic acid bindingGO:0003676IEA
helicase activityGO:0004386IEA
*** None ***
*** None ***
Sequence
        2607 bases(100 bases per row)
ATGGCGGGCGACGATCTCCTCAAGGGCAAGGGCGCCAGCGCCGGCGGCGGCACCACGCACGGCAAGAGCAATGGCAAGGGCGCAGGCGTGGGCGGCTTCC
AGAACCTCGGGCTGAGCCCGCCGATCTTCCGTGGTGTCTTTGCCATGGGCTACAAGGTCCCGACGCCCATCCAGCGGAAGACGCTGCCCATTGTGCTCTC
GGGCAAGGATGTCGTGGCCATGGCGCGTACTGGTAGTGGTAAGACAGCCGCGTTCTTGATCCCGATGCTCGAGAAGCTCAAGGAGCACTCGAAGAAGATT
GGCGTGCGTGCCGTCGTGCTTTCGCCGACGCGTGAACTCGCGGTGCAGACCTTGCGCTTCGCCAAGTCATTGGCCAAGTTCACGAGCATCAAGATCTCGC
TCATCGTGGGTGGTGAAGGCATGGAGGCGCAGTTCGAGATGATTGCGTCGAACCCCGACGTGATTGTTGCCACGCCCGGTCGTCTCATGCACCACCTCCA
AGAGATTCCGGATTTCAACCTCAAGGCTGTCGAATACGTCGTGTTCGATGAAGCTGATCGTCTGTTCGAAATGGGTTTCGCCGAGCAGCTGACTGAAGTG
CTCAAGAGCATGCCAGCGAGTCGACAGACGCTGCTGTTCTCGGCAACGCTGCCCAAGGCCATCGTGAGCTTTGCCCGTGCCGGTCTGAACGAGCCCGAGC
TCATTCGTCTTGACGTCGAAAACaAGATTTCCGAGAACCTCAAAATGACGTTCTTCACCGTGCGCACGGCTGACaAACCGGCGCTGTTCCTGTACATGGT
ACGCGAGTTCATcCCgAAGGACGACCAGACGATTGTGTTCGCCGCTACTCGCCACCACGTCGAGTTCTTACATGAACTGCTCAAGGCAAAcCACATCGAA
TCGTCGCTCGtGTACGGTGAAATGGACCAGGCGTCTCGCAAGATCAACATCGGGAAGTTCCGTGCCAAGAAGACCAACCTGCTTATTGTGACGGACGTCG
CCGCGCGTGGTATCGATATTCCACTGCTGAACaACGTGtTCAATTAcTCGTTcCCGcCCACgGcCaagCTCtttgtgcatcgtgNNNNNNNNNNNNNNNN
NNNNGTCGATCCAGATGAGACGCCGTACATGGTCGactTGCACTTGTACATTGGCCGTcGTCTCGAAGACTCGTCGCCACACAAGGCCAACGCGTACTCG
CTATCGACGATGCAGGTCTCGGACATCCATTACGGTGCGTTCCCGAACGAGCTGaTCGATCAGGAGACCGAACACACACAGGAGATCCTGCGTAGCAACT
CGGCtGTCCAGCCGCTCGTGAAGGTGTGCGCCAACGCCTaTAAAATGTACACCCGCACCCGTGCGGATCCATCCAAGCTGTCGATTAAGCGTGCGAAGGA
GCTGCAtGTAACCAAGATCCATCCATTCTTCTTGGCCGAATACGTCCAGGAGGAGTCGAAGATCGAGAAGGTCGCGTACATCGAAAGTCTGCAAAAGTTC
CGCCCACAGGCAACGATCTTCGAGGTTTCGACGACGGCCCACTCGATCAAGAAGACGGCGCCGAGCATGGTGATGATGCAGACCAAACGTAAACTTCACG
AAAAGATCATCGTGAAGGAGAAGACCAAGCCGAAGAACGGCGAGATCGAGGACGAGTTCAGCAATCTGAAAGATGAGGACGACGACGTCGACATGAATAG
TAACGACGTGAAGCCTTCGGCAGAGAAGCAGGCAACCTCCAAGGTGGTAGATGAGCCGATGCAGGAGGAGGTGGAGGCTCCTGCGCCAAAGAAGAAGTCT
GTCTTCTTGTCCAAGTTCGAGCGTAAGCAGCTGAAGAAGCGTGTCGCTGCTGGCGAAAAGGAAGAGGATGTCATGAAGGAGTTCGCTGCTGCCAAAGAGG
CCAAACAGGCTGCTGCAGGTGGAAGCGGCTCGGCCGAGGAGGGTGACGAGGAAGCAGACGACGACGAGAACGGCGGAAAGTTTAAGGATAAGGAGAACTA
CATCGGCTACATGAAGGAAGGCGAATACATGACGGAGGAGTTCCTGTCCAAGGGCGCTGATGGCGGGAAAAACTCGTTCCAGGACGCGCGCCTCGAGGAG
GCGGTTTTGGACGTGAACCCAGATGAAGCGGCCGAGATGAACAAGAAGCGTCGCGTGCTGCACTGGGACACCCGTAAGAAGAAGTTCGTGAAGACGTCGG
TGAGTGAGATCACGGCGACTGGTGCACTCAAGCGCCGCAATGAGAGTGGCGCCGTGGTCAAGAAGAAGCACCAGGTTGGTGAGCTGTACAAGAAGTGGCA
GCAGCGCAACCACAAGCGTGTGTTCACGGGCGGTGAAGAAGCTGACGACGAGAGTGGCAAGCGTCTGGACTACCGCAACGGCAAGAAGCCTCGCCTCACT
GGTCCCAACGTCAAGACAAGCGTCAACAAGCACGTCAAGGACGAGCTGCTCAGCGAGTCCAAGATCCGCAAGGAAGAGAAGCGCAAGGCTCGTTCGCGTg
GCGTCAAGCCAACGTCGAACAAGAACAAGAGCAAGCGTGGCAAGGGCAACATCGTGGGCAAGAGCCACGGTGCGCCGTcCCGAAGCAAGGCCATCATCCG
ACGATAG