Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-snap-gene-0.47
Orientation:
(-)
Number of Exons:
6
Description :
Telomerase reverse transcriptase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Telomere reverse transcriptase5.2PR01365
Telomere reverse transcriptase5.2PR01365
Telomere reverse transcriptase5.2PR01365
Profile scan predictionP-Valprediction_id
Reverse transcriptase32.429PS50878
HmmSmart predictionP-Valprediction_id
Telomerase ribonucleoprotein complex - RNA-binding domain4.3SM00975
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-978
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
DNA bindingGO:0003677IEA
RNA bindingGO:0003723IEA
nucleusGO:0005634IEA
RNA-dependent DNA replicationGO:0006278IEA
KO ID
K11126
*** None ***
Sequence
        3255 bases(100 bases per row)
ATGCCTGTGTTCAAGATCGCAGGAAAGAGTCTTCGTTGGTTATATTTCACGCAACAGCCAACGATTCAACAAGCaAAAAAACGCAAGCGAGCAGACTTTG
GGTCGCTGGAAACTGCTCAGGGCAGGAAAACTACTGTATCGATCAATCAAGTCATGTACGCTCGGCACTTTCAGAAGCGACGATTACTTGCAAACACAAG
TCTTGGGGCTCACATTCCAAAAGGAGCAGACGTATCGCGACGACTGGCTTCAAAAATTATCACAAGTATATTCCCTGAAGAAGCTGGGAAAAGAAGACTC
TCCAAGCGTCTCGTAAATCTTGTCCCCCTCGTTCAAGATATGATTTTGCGGGTTCAGCAATTCGAAGAGAAACCATTTTTGGATCCAATTAAGGTGAACC
TGTTGTCGTCTCAAGCGGGATTCGGAGCAAGGTCGTTGTCGATTCCAACCCGCAATGTGCGATGGAATCCAGATTTGCTGAGCGCAACGGATGACGGCTA
CATCACACAACCCGAATCACCTGATCGAATCATGGAACGGAAGCGAAAACGAAGAGAGGGTGCAATCGAAGCTGTATCCACTTATGCATCATCTAGTGAT
TCCTCGGTTAAAAGGAGGAAGCAAGTCAGGTTTGACACGGCACATTCTGTCGATAGAAGTGAGCTGGAGACTTCATCTGCACTTACACGCCTCACTGGAC
TTCAATCGCATCGCGAAGACATCACGACATTATTGCACAATTCCGTTCCAACAAAGCGGATCCAACGAATGGTACGCAAGTTGGTGTCGACCATCGTACC
GAAGGCAATTTGGGGTGCAACGACACGAGGTTGCAAAGATCAGAGAACCAACTGGGAGGAAGTGGTACTATATCTGAAGAAACTTATTCAGTCAAAGCAG
CACGACTCTATCTGTGTGGACAAGGTGCGTGTCaAAGtATGTTTTgGGCCGAGCCATCGATGCGACTGATCACTCCACCCTTACAGGTTGCGTCACGACT
TCGACTaAAAGATATCACATGGATGGATGCTTCTGGCAAATCTGCGTGGTAAGTCTCGTGCGTACAGTGTCCGCGGACAAGATTCTAATTTCCCATGAGA
TATCTTAGTCCGCCGAATGAGCTCGCGAAGCGGAAGAGCATTGTTGTGCAGCTTCTACATTGGGTCACGCTTGAGATAGTATTTCCGTTTCTTCGAAGCT
GTTTCTACGTTACTGAATGCGAAGGTTCTGCGAACGAGGTTTACTACTATCCGCGTGAGGTGTGGAGCGCAGTAAGGTGGGTGAACAGTTGCGCATCACT
AACCTGCATTGGAAGGGAATCTAACTTTGTCATCGTAGCTCACTCGCACTCCATGATCTAACCTCATCGATTATGAGGCCTGTTAGTCGTGCCGAATTGA
ATCTGACCTCGAAAGAGCTTGCCACATCTCGACTGCGATTGCTTCCGAAAGTCAGTGGTGTTCGGCCACTTATCAATTTGTCaGGAAAAAGCGTAGACAA
CAACCTATCGGTCAACAAGACCATGGAGTTGGTGCATCGGGTTCTACTTTATGAAATTGATCGACAGAAAACGCGGTTCCTTGGATCCACTGTGCGAAAT
GTGGACGAGATAACCTTTAAACTTGAAAGtTTTTTTGCCGAGATCGACAAATGCGGATGCCAGCAACGCAAACAGGCGAACACATTCGTTGCGACAGTTG
ATGTTGAAAGATGTTTTGATACTATTCGGCCGAAGAAGCTTTTGCACATACTCAAGAAAGTATTTGTGGAGGACGAGTATCTGATCCGTAAGCATTGGGT
ATGCAAGGGATCACACTACAAGATGGAAAGACCTGCTGGACCCTCTGGGGATCTGAAGGGTTTCACTTCTCTAGTTCGACAAACCGGGaAgAGACCGAAC
GCCGTCTACGTTGATGGTGTCTTGTACGACTACATAAAGaAAAACGACATTTTAAGGCTGCTTCGTGAGCACCTCACCGCCAATACAGTCCAAGCTGATG
ACCAGGTTTTTCtACAAGCCCAAGGAATTCCCCAAGGTTCTGTTTTGTCCACGGCACTATGCAATTTGTACTACGCGTACTTCGAGAAGAGCTTTCTATT
GAAGAAGCTCGACGTCTCTCAGCCTGTGGATCCAACCACGATGAAGTGCAATCACAACCTCTTGCTACGATACACAGATGACTTTCTGTTCATTTCGACG
AGGGTCACAGAGGCTCGACGATTTACTGAGCTTCTTCACCAGGGGAATGACGACTACGGGTGCTATGTCAATTTCAAGAAAAGCCTTGTAAAcTTCCCAG
CTACTGTGTCCGATGCGCATGGTGTGCCACGAACAGTTCCACGATTTGATGAGACTGCTAACGGATTTGTGCCATGGTGTGGGCTGCTAATCGATCCCAC
AAACAGGCAGATTTACGtCAATTACGAGaGGTAACCCAGGTTATGTCCACCATTTACCGCATCAACTAACGATGCTCTTGCTGtTTTTGCAACTGACTCA
GACTTACTCTGCATGCAATAGCAGCTTCCATTCCGGTCGACGAGACGAAAAGTATGAGGGAAGTGTTGGTAAATAGGGTGCTTGCTGCTGTTCGACAACG
ATGGCATCGAGTGTACTTCGACCCAACACTTCTTCTGCCATCTACGATTCAGGTTCGTTTGTTTATCCTCTTGGGTATTTTGGATGGTTTAAAAGTCAAT
TGCTGCTGGGTCTAGATCAATATCTTCCAGCTCATATGCCTCGCGGCTTTGCGATTAATCCTATTGGTGGATAAACAACTTCCTCAAGAAGAAGAGACGC
CAGTAGCGTTCATCACGAGTTCGATCTTCTCGGTTGTAAACAAGAATGCTCGTGGGATCCTTCGCACCCTTACACCAGGTCGTTGTGTGGCTAGACGCGC
AATCAATCACCTCATCTGGATTACCGGTCTGCAAAGTTTCATCGTGGTGATTACGCACTGCAAGCTTCGTGGAATCAATCGAACCCATCGAAAGGTCGCG
TGCCCGAGCATCTCATCGCCGTCTTCATCGCGATCTCAATGGGCTCTCGTCGTGGATTCGTTGACTCGAAGGCAACATCGCTTACTTGCGCTTGAAGAAA
CCACATTTGGTGAGTCCCACACGCCTCGTCCTCTCGAAGTCACCTCCCTTCTCGACCCAGCTGCGCTTTCTGAAGACTCTCGGAACAAGCAGATCTGGCA
ATgGCTCGACGCGTACAGTATTCGTTCCGCGAAGAACAACTCATTGAGAACATGA