Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-snap-gene-1.36
Orientation:
(+)
Number of Exons:
2
Description :
Myosin
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, FYVE-related11.407PS50178
HmmSmart predictionP-Valprediction_id
FYVE zinc finger4.5SM00064
GAF domain0.0088SM00065
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Zinc finger, FYVE-relatedIPR017455
*** None ***
InsideOutsideTMhelix
1-442
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
metal ion bindingGO:0046872IEA
*** None ***
*** None ***
Sequence
        1387 bases(100 bases per row)
ATGTCGCGACGCGGAGTCAAGGGTGCTCGCATGGGCGGTAACGACGTGCTCACGATCGACCAGCTCCGCCACCAGGACGACTGGGTGCTCGACACGGAGC
GCTACCGCTGCCACGTGTGCACGCGCAACTTCACGCACTTCCGACGAAAGCACCACTGCCGCAAGGTGCGTCCTCCTCCCTCCTCCTCCCTTtCcTCACA
CTAACACGATCATCATGCTTTAGTGTGGTGAGGTTGTCTGCAGTAACTGTACGCTCAaGAAAGAGGCcgAGCTGCCCGTCATTGGCCGCTCCATGGTCAA
GGTGTGCATGTCGTGTATATTGTCGCACGCCAATGGCCaGGCCAACCCGCAGGCGCCGTCCGTAGCGCCCACGTCCACGACGTCGTCGTCGTCGCCGCCA
CGCGCTGACCAGGCGCACTGGGACCCGAAGAGCTTCCATTCGCCCACGGGCAACTCGGAAGGCGACTTCTCCCAGTACACGCGCGACTTCCACCAGCCCG
AGTTCGACTACCCGCTCGACTTCAACTGGGACCACCCGTGGCCCAAGCCGCCGATCGTCGCCGGCGAGAAGGAGCGTCTCGATGTGCTCCGTTCGTTCGA
CATTATGGACACCCCAACCGAGGACGTGTTCGACATTAtCTGTGACTTGGCCAGCAACGCCCTCAAGACGCCGATCGCGGCCGTGAGTCTGCTGGACGAT
GACCGCGAGTGGTTCAAGGCCAGCGTCGGCCTCGCGCAGAACGAAGTGCCACGCTCGGTGTCGTTCTGTGCGCACGCCGTCATGTCCAAGGaGCCGATGG
TCGTGCTGGACACGCTGCTCGACAAGCGCTTTGCCAAGAACCCGCTTGTGACGGGCGCGGCGAAGATCCGCTTCTACGCTGGGGCGCCGATCATCACACC
CACGGGCCACATTCTCGGCACAGTGTTCGTCTTTGACACGCAGCCACGGACCACGTGCGACATCGCAACGCTCGAGAAGCTCTCGAACGTGGCTATGAAG
AACCTCGAGGACCGCAAGAACGCCCTGTTGGCACCCGTGGAACCAGGCATGGAGGCACCAGTGCGTGCGCCCGTGCCACGACCAGACCCAACGACGCGCG
GGTCGGTGAATGGTATCGCGAACCAGGTTGTCGCCGCGCCCGTGGCCGCCCcACAGTCGCAGGATCTTGTGGCGGCCAATATGGCAGGCGATGGCCAGGT
CACGACGGGTCCGAAGATGGAGACGATGCTCATGGATCTGCTGTGCCGTACGACCGAGACGCAGCAGCAGTTAGCGACACAACAGGGTGCGATGTTCCAC
ACATTAGGCCAGCACACGGCGGAGATCGACAAGCTCCAGCACGCGATGGCAAGAATGGAAGCCAAGTTAGACTCTCTTGCCGAGTAG