Transcript Name :
Pytap_DAOMBR444fgenesh_masked-pag1_scaffold_1-abinit-gene-1.116
Orientation:
(+)
Number of Exons:
1
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1691
*** None ***
PositionContextScore
179RQSRNKR|SQ0.82
867LKSRKRR|SH0.842
1659TASRRLR|RI0.566
1660ASRRLRR|IE0.548
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        5076 bases(100 bases per row)
ATGGAAGCAGAGCCCATCGCCATCGACAGTGCGCCTGTGCTCGTGCCGATCCGCTCGTCGTCTCTGCAATCCAATGAGAAGCTCGTGCTCAATGTGAAGG
ACGTGGTGTTGGCGAATCGCCTGCTGAACGTCCGCATCTACCAAGTCTTCCAGACATCCGCAGGCGCCGCGTCAACGGCGTCTACCATCGACTTTGCTGG
CTACCGAGTCGCCGCGAACGACGAAGTGGACAATGACTACGCCATGTTCCTCTCGCGAATCAAGGGGgAgCAGATCTACCGAGCAGTACGAAGTCCTGAG
ACTACAGGGACACCACGCGGCACGTCGACTCCCGAGGTCGTCGCCAATGCCATCCTCACACATCTCGACATCATCGGCAATCGCCACCGAGACATTGGCC
GGCTAATCTGTCGCGAACCAGAGGTCAAGATGGTGAGGAAGGAGCGAGTCGTCCCACCGCCCAAGACGCCGTCCAAGATCCGAAATGCCCACTTGCACGC
CAAAGAGCAGGACAAGCGGCAGAGTCGCAACAAGCGAAGCCAGGAACGCACGCACGAGGCCATTGCGGCATCCCATGAGCAGCCACGGGCGAAGGAGAGT
CAACAGCAGCAACCAGAGGAGCCAAACGAACCACAGGATCTCGAGGTGACTTCACCCTCCGCTAAGGAACGCAAGTCGAGGAAAAGCAGTGAAGCCAGCC
TTCTCCACCGCATGGCCAATGCGAACGCCCGAACAGTGTGGCGGACGCAGCTCGAAGGCATTGATGACGACTCGGCCGAGTACATGGAGATCTTCGAGGA
AGCCAGTGTGAAAagCGATATCACAGAGCTCGAGGACTcGGCCCCCAGTCGCACGGCATCAACGACCAGCTCAGCGAACTACAAGCGAGCACTGCCAGCT
CGAAAGCCCAAGTACCGAGGGCTACAGCAGCGACGCGACAAGGAACGGAACCAGCGTCTACAGGTGCTCAAGGCGATCGTCGTGAAGCCTAGCAACTCGC
CACCGCGACAGACTCCTTCCTCGCGTCAGAACAGTGTGTCCACTGACCGGCAGTCATCCATGGCAATCGCCACAGCCCCAACCAGTCCGTCAGCACCGCT
GCTTCCAATATGGACGACAGCTCTGGCTGCGAGTGCTATGATCGGGAAcGCCCATGCACTCAAGACGATCGTTGGCTCGGCTCCGGAACAGGAGCAGTtC
CTACGTCGCAAGACGATCCGAGGATCGATCAAGCGAGTGTTCAAGGAAGAGAGCGTGTTCAACGACGCCCTGGGCGTCGAGATCACACACGAACGCCCCG
ATCGACGTGCCAGTATGAGTGACGACGACTCGCCTGATGTGATGTTGCAGAAGCGCATGGTGCAGCAGAACTCACGGCGCAGCtCGTTGGTGCGGGACGA
AGACGGCAATCTCAGTCGACGCCCCAGCACCAAAGGATCCCAACGACGACTGTCGCTCAGTGCCCAGCAGATCGAGGCAGCCGTCTCACGAGGCGACGGC
GTGTCGCTCGGTGGCTCAGTCTCGGCACCAACGTTATTGATGGCAGAGGAGGTGAAGACGTCACCGCGGCCCGAGCTACAGTCTGCTGATGGCCAAGAAG
GAGAAGAGGACAGAGAAGACGATGATAGGGAGAGGAGTGAAGAAGGTGATGAAGATCAAGAAAGTGGTGGAGATGAAGATGACGAGAAGGATGCAAAGGA
GAACGACACAAAGTGTCTCGATCAACCGACGCTGCAACAAGATGCCGAAGTGGCTGTGGCCGGTGGCGTACTTGACGATGTTGAAGAGTTTCCGCTTGAC
GTCGTTCCAACTGGCGACAACGCATTGAATGGGCgTGAAGATGAAGAAGATACGATACGAAACGAGAGAGAAGATGAAGAGCTGTCAATGAGGTCACCaC
TACAGCCCGcATCGACAGGCCTATTTCCTACCATTGATATTTGCGAGGACGAGCCTGTGCCTATTGACTGCACCGCACCGAACGTCGTGGTCGAGTCTGA
GCAGACCACCGAGTCCGAGAGTTCAGCGATGGACAGAGTGCTCAGTAGCCCACGCGTTGAGTGCTGGGAAGAGCCCACGCCAACGCCATTCCTCTTAGCT
GCTGACCCTAACACTGAGCCTGTCCATACGGACACAGCAGCGTGTATGCGCTCACCAGTCGTCAGTCCGTGCTTGTCGCTGCCTGCACAGATCGAAGAGC
TCTCGGAAGGACGGGAGATGACGGACTTCGTCACAGAAGCTCATCCGGAGCCTGAGTGGATAGTCCCGACCACAGACGAAGAGCTCAAGGCGGTGGATGA
CACCCACGACGATCACGAAGACCCAGTGATTGAGTTCGAGCTCACGCCTCCTCTAGTCGTCCGACGTTCCAATGTGGAGATGGAGCAGCCTGACACGTCG
CATCATGAACCAGAAGCCATCGATCCCTTTCCGATCACACTTTCtCCTCCAAGAAGCCGACGGAATTCCGTCCTTGATGTCCATGCGAATGCCATCGCGG
CTGCGGCCGCTGCCGCCGCTGTTACTGCTGTTGCGACGGATGCTGTGGCAGTCTCATCAAGTCCAAAAGCGGACCAACAGCTCAAGTCTCGGAAGCGACG
ATCTCACGATGCGACAGCGACCATAAGCGGGCTTATTGCTGTGCATACAAAGAGGGACGGAGCACGGCGGTCGACTTTGCTGCATATCGCACAGAGTGGA
GGCGTGGATCGAAAGCCAGTCGTCGAAAGCAGGACGTCTGACGAGTCGAACGATGATACTCCGACATCAACATCGAGTGAGACGAGCACCGAAGTAGAGA
CGACTGAAGCACCGAAAGAAGAGGCGAAAACAGCGGTGGAACCAGCTCTCAGCCCTGCAAAACCGGTTACCAAACGTCGATCTCAAGCGGAGACCGACGC
GCTCATGCAGTCACCAACATACCACGCCAAGTGGCGGCAATGGGTGAACCAGAGGCAACTCGTGGAGAAAGTTGGATGCCTTCAGCTCGAAGAAGAACTC
TTACAAGACCCCCATAACGAGCACAAGCTCATTCGACTCGGTCTACGGTATGCCAGGTGGCCCGCCACGAGTCTTGCGGCCGTCGTGCTGCTAGAGCACG
CTTCTGTCGTCCACAACAGCACGCTCACACACACGCTCGACTATTGGAACGCAATGGGCAATGGGCACTTCGACGTGTTCCTTCGGCACCGCAAGTTTCT
GCCTGTCGCGAGTTTCCACTTGGCGAAAAGCATCCAGGCCTTCACCCACACGTTCGCCTTCATCGAAaGCCTCGCAGACCCATTGCTACTGCTTCGGTAC
GCCGTGTGTCTCTACTGGAAGAAaGGCGAGCAGCATCTCGAGCGAGCCGATGATATCTTCcATGAGCTCTTCACCAAGTTCGCGTCATTTTGTGAAAGCG
ACGCGCTCAACTTGCGATTCCTTCACTTTCAGATCCtGTTCCGACTGAAAATGCTGAGCGAGGCCACTGAGATTCTTCACAAGGTCATGGCAGCGCACTC
ACAGCTCCTGGCATCGTTGTCAGCACGTGAGGAGACCCGCAGTCCGAGAGACCTCCTGACTGTTTACGAGGCTAGCGACTACTTGCTCATGCTCATGCAT
TGTCAACAGGCGAGTGGCGATTTCCTTCAGGCTTCGACGACTTTCTCGCAGCTCGTGAGAGCGCATCCCAAGCTTTTGGGAAACGCGCTCGATATTGGAA
GCATGGAGGACGCCGACTATCTCCTTCTGTGGGGATCGCTAGCCGACAAGTGTCTCCACCATGAAGATTACGCCTTGGCCATCGAGTTCTACGACATCAC
GGCGACCTACGCCAAGGACTCCCGCGTGATGACGCGACTCGTGTACAGCCGAGCGTTGTGCCTTCAGGCATTAGGAGAAGACGTCAAGTGCACGGCCGAG
TTCAAACGAGCGCGCAACTTGAATCGCCACGTAGTGCCGTACGCGACGCTGGCTGAGATCCACGCCCGATACGATGACCAGTACACGACGCTGCTGCGCA
CGCCAGTGGCAGAGATCATCGCGGAAGTACGGCAAACGCTCTACGATCGTGCGGTCACGACATTGCAGCGTGTCTTCCGACGGAAGCAAAGCTCGAAGAA
AGGCTCGACCCTCGAATCGCGACGTACGAGCTTGAAAAAACGACAGTCAAGCAATAACCTGAACGCAGGTGCGGACAGACAACGCCAAGCGAGTGCGCGA
TCCCTCGCGTCTCATGGGGAGGAGAATGCAGACGACGAGACGGCTGCAAGTGAGAACGGTGGAGGAGCTCGAGAGGCGTTCGCGCGTCGTCGAGCAGTTG
CGATGGACAAACTCAAGCGCATGCGAGAGCGTCCGCTATGGAAAGCGTCAAGTTTTACGGAGACAGCGGCCAACCGAGTGGCCATTGAGGCCGCGGCGGC
GCGCTCAAGCGGCCTGCTCTCGCCCGTGAAGGATCGGTTGGACTTGCAGCGCAAACACTCGATGGATTCAGTCGCGAGGCATCTCGGTTACGTACCAACG
ACACATGCACGATACTTCGACCACTGGGAACAGCTCGTGGGGACGATGCTGGATTTGTACGAGTCAAGATCGAGTCTCTATCGCCACATCGCTCGTATTC
GTTGCTTGTTGCCTCATGTGTCCGAAGACGTGGCGTGCTGTGCACTGGCGAATGCGTTAGGAGACGTAGACGCCGCGATTGAGAAACTCCACGACATGAC
ATTCGAACACGAACTCCGTCTTGTGTGTGCGGTTGCCCATGTTTCCAAGaCAGTTGAGAAACATTTCTCACTTCGTGATGATGCCAATGCCGTTCGCTTC
CCGCCCATCCAGTCGCCTGCCAAGTCTCCAACTGGGACGTACTCACCTGTGGCTAATCCGAAATCGCATCGaTCGACGCCATCACTCCCAGCGTGCTCAT
CGTCACCAGTGCAGAAGAAGACAGTGCGTCTCTCGAGTCTAATTGACTCAGAAATCACAGCCTCAAGgCGTCTGCGTCGTATAGAGGACGAAGAGCACGC
GGCAGTTGATGAGTTTGCGGTCTTGGACCATTTCCGCCACGTGAATGCGTCGCTCCTACATGGCTGGCAACGATAG