Transcript Name :
Pytiw_DAOMBR242034maker-piw_contig_3103-fgenesh-gene-0.0
Orientation:
(-)
Number of Exons:
3
Description :
Pleckstriny domain-containing protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-281
*** None ***
PositionContextScore
194GPWVVKK|SV0.529
TypeScore
nuclear348
GO
*** None ***
*** None ***
*** None ***
Sequence
        1007 bases(100 bases per row)
ATGCAGAAACTCTGTCCGCTTGAGCTTCAGGTGGAGCACACCACGCGCTCCGCCAAAGGTAAATGTGCTGGTGCCATAGCGTTCACGAGCAAGTCGTAAA
GGTCTAACTGCATTCGTTGCTTGCTACTGCGTGTGTTGCAGAGGCGGAGAGCTCGCCGACGTCCAAGTCGCCTATTGGCTTCCGATCCTGGAAAGACCAG
GCGCAGAGCTGCGTCTCCCAGGATGCCAAGCTGCGCAAGATGTGGCTCGAGCCGGACTGGGCGGGCTTCAACGTCCGCTCCAAGAGCTACCTGCAGACCA
AGCTCAAGGAAACGACCGAGTCACCTCGTAAGTCACATTGTCATCCATTCAACGCATGCTACCAAGAGCTACACTAACCGCCACTCTTGCGTTGACCTCC
GCTAGTGTTTGAGCTCGTTTGGTTCGACCTCTTCAGCGGCAAGCACGAAGACCTGCTGCATATCTCGCAGTCTAAGAAGAGCTTCGTGCAGAAGGCGATC
GCCAAGTACAGCAACGATGTCCCACAGCTCTTCGCCGTCACGCTCATCATCCCAGGCACGCCGCTGGTCGCCTGTGTGCAGTACTTTGCGCTCAAGCGAG
ACAAAGCTAGCACGCATTCTTCGCGCGTGCATCACGAGGGCGAAGCGCTCTGGGCGCGTTTCCTCGCTGGCGACGACGCGTTCCGTAAGTGCCGCTTCAA
GCTCATTCCAGGCATCCCCGAGGGCCCCTGGGTCGTCAAGAAGAGTGTGGGCGCCAAGCCCGTGATCCTCTCACATGGGCTCGAAGTGACCTACTTCCAG
GGCCAGACGTACCTCGAAGCCGTCATCGACGTCTCTTCCGACCGAGTCGCCAAGCACGTGACTGCGCTCTGTCGCTCGCACTCGACGTCGCTGAAAGTAG
ACATGGGCTTTGTGGTCGAAGGCATCGACGAGGCAGAGCTCCCCGAAGTGCTACTCAGCTGCGTGCAGTACGACCACCTTGATCTCACGCTCGCCACGCC
GATTTGA