Transcript Name :
Pytiw_DAOMBR242034maker-piw_contig_2364-snap-gene-0.3
Orientation:
(-)
Number of Exons:
4
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-329
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1051 bases(100 bases per row)
TGCCCATTCGCTCCAGCGGCTGCGGTACAACTTACCATCCAAGCGCCTCAAGTCTACATAACCCCAACTCGCACTCATCGTCAAAGAAAGTCACTACTGG
CGACAGCAGGCAGACGCAGATCTCAAGCTTCTTTGTCCAAACGCACAACCCAGACAAAATCCAGGAACTTGAGCGCCTTCTAGTAGAGTTCCAAGCCGAC
AACCAGCTTCCTGATTCGTTCGTGGACAGGATGTCAACCAAGCGCCTCTTCGATTTCATGGATCCTGCGAGTCTCGCTTCCTTCCCGACACGACAAGCCA
TCGGTGGGCGACTTCTGGATGAGTACGCACAAAAAGGATCGCGCCAATCGGCAGACGCGCTGCTGCAACTCCAAGGCAGGATGAGCGGCGAGTGAATTTT
CTCAGTGATGTGTGGCAAAACATTGCCAAATCACACCTCTTGGGGTGCCAGTTGACGCTGTTTGGCAGTGTTCATAATCTCGGGGTTTACCAGTCTGGGG
TTCGCCACTATGGACTCGCGATCGCGCAGCAGATAGAGCACTACTCAAATCAACAGTTCAACCCGGGTGGACTGTCGGAACTGTGATGACGGATAACGCT
GGGCAGTGCGGTTGCGCACGTCGCATCCTCGCCCTCCGCTGGCCGAAAGTGGTTTCCTGCTCTGCTTCGCTCACGACGTGAACAACTTGGTAAAGACCGT
GCTGCAGTCGTTTCGAGATATCACTGCTCGAGCTTCCGCCGCTGCGAACACTCTCAATGTTTCATCGTCGAAGTGGCTTGTTTTAGCTCGCCGGGCCATG
GTGGAAACGTATGGTGAGGCGCGCGCTTATAACGCTGTGTGAAACCCGCTGGAACTCGATGCAAGGGTGTTTTGCGTCTCTTCTCCGCGTGAAGTCAGCC
CTCGAAGTGTTCGCGATGAAACATCGGGATGCACTGGACTTTCCCGAAGTGCTATCTGTCTTGGACCAGCGATCGTTCTCGGAGAGTCTCCACGATTCAG
AGGTGGTCGTGCGACCGCTTTGCTTTGCGTCGTACAAGCTTCAATGCGACT