Transcript Name :
Pytiw_DAOMBR242034snap-piw_contig_2270-abinit-gene-0.10
Orientation:
(+)
Number of Exons:
2
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, C2H29.494PS50157
HmmSmart predictionP-Valprediction_id
Zinc finger, C2H2-like25SM00355
Zinc finger, C2H2-like0.22SM00355
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Zinc finger, C2H2-likeIPR015880
*** None ***
InsideOutsideTMhelix
1-763
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
metal ion bindingGO:0046872IEA
*** None ***
*** None ***
Sequence
        2649 bases(100 bases per row)
ACGCGCGACGGACCGGACCTGAGCCAGCAGAAGATAGACGCCAAGAACGAGAAATGCCAGTTCCACAACTGCCCGAACCGCGCGCGCGTCTCGCAGGCCT
ACGGGAAGTTCTGCAACCGCCACGTGATCGTCGCGCCGTGCGGCTTCCCCGGGTGTCGCGACAAGGCGCTCCTGAACGCGTCCATGTGCGAGAAGCACCT
ACAAGAAGGCAAGGACGCGCTGCACAAGGTGCTGGCCACGCGTGCGCAGAACGTGCCCGTGTGCCGCACGTTTGGCTGCTTCAAGAACGACCAGGGAAGA
GGCTACTGCCGCGGCCACGAGAAGCTCCTCATGGCTACGGGTCGCCTGCCCAAGCACGTCAACAAGCGGCGCCTCAACAGCGCGTACACGATGTGCAGCT
ACCCAGGTTGTGACAAGCACTCGCAGCGACACCACCTCTGCCGGACCCACGGCAACCTGATCTCGAAGCAAGCCGAGGAGCTCCACACGCGGTCCAACGG
AGAGACCTACGAGGAGATTCTGCTGCGGCTCCAGCAGAATGTGCGCAAGTGCACCAACCCGACGTGCACCAAGAACTCGCAGCGCGACCGACTCTGTACG
ATGCACTACTATGAGAAGCTCAACCCGCCGGCTGATGGAGCGAGCGGTGACGCCAACTCGGAGCAACAGAGCGAAGTCGCCGCACCAGCTCCGGGAACGG
AAGCTGCGCCAGTATGCAGCGTGTCAGATTGCAACATGCAGGCGATGACGAAGGGTGTGTGCAAGTATCACTCTGGACAAGGACAAAATACAAAGAAGCA
GCCTGTGGGGAGTGACGCGGCCACGGCAGCGGCGGTGAGTGGGATCCGAGAAGTCGAGCCAACGCGGTGCAACGTGGCGGACTGTGTCCAGGTGTCGTAC
TCTTCCGGGATGTGTCTACAGCATTTCAACCAACATCGACAGCAACTGCAGCAGCAACAACGACAGCAACAGCAGCTGCTCCAGCAACAACAGCAGCAGC
AGCAACAGATGCAGCATTATCAACATCAGCAGCAGCAGGAGCAGGAACGAGGACATTCAGTGCAAGGAAGCAGATACAGCAGCAGCGTGATCTCACCGTT
TGGAGATGACCGCTTCAACACGCCTATGGACCCGACTCTTTCAGCACGGCCCGGCATGGAGAGCTATTATCCTGGTGGCGGCGCGTATGGGGCACCGATG
GATCCAAATATGAGCAGCTATCCACCGATGAGCAGCTCTGAGAGACACCTCTCTGGACCTGGACCATCGGGTGGTGAAAGCGAAGCCAAGCAAGCGCTAT
TCAGTCTCAATGCGAAGCTGACTGATCCCGGACGAGCCTACAACCCGCACGACGAAGGTGGTGTGTATCGAAGTGGCTCGGTGTGCAGCAATCTGATTTG
CAATCGGCAGACGTATGGCCGCGAGTACTGCGACTCGTGCCAGAGCATGGTCCCTCCACTCGTCGGCGATTCGCTATCTGGAGGAGGAGGAGTTGGGGCT
TCCTCGTATGCCTACTCAGCGAGTGCCCAGCCGGATCCCGAGACCAGTCCACAAGGTTGGGGAGACGCAGCGCCTCAGACGAAGCTGCCGCTCGCAAAGG
CGTATGAAGTCTGCCGGGTGGGTCAATGTGGTGCGATCGTCCCGAGCCTCGCGAATGGAGGTCTCTGTGATCTCCACTTTCGCTCATTCGAAGCCGGCGA
TCTGTCAGTCGACGAGCTCATGTTGCGGTCCAAGGTGCTCGAGAAGGAAAACCACGCTAGCGCTGCGGCGGCGGCTGGCGGCAACAAGAGTCCAACTGGT
GGCAAGGGGAGGAAGTATTTCTGCAAGACTGATGGCTGTGGCAAGCAAGCGCAGCGCAAGGGTCTCTGTAAGAGGCACCTCCGTCTTCACGAGCAGGAGA
CTTCAGCGAAAAAGGCGAAAATAGACTCGGCGAGTGACTTTGCTTCCCCGAACCAAGCGAGTGCTGTCATCAGTCAGGCAACCTCGACACCCTGCCGCTT
TCCGAGATGCAGCCAGCTTGTTGGCCGGAATGCCCCGTGGCTGTGCACTGCTCACGCGAACGCAAGCTTCTGCTGGCAGCCTGGCTGCGAGAAAATTGTC
GACGGGCCCCAGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTCGCTGC
AGCCACGAACACTGTGACAAGTTCACCGTCGGGACGACCGGTGTGCGCTGCCGGCTTCACCAGATCAGCTGCAAGGAAGAGCCCTGCGCGCTGTGCGAGC
TACACGGTCTCGGCTCGGAGAACGTCGTCGTCAGTAGCAGCACCACCAGACGACCCGCAACGCCGCGAGATCGCACTGGAGCTGGTGGCAAGGGCGGCAG
TCGGCGGAAAGCCAATTCCGAGAACCTCCAAGCTGGCGGCAACCAGTAA