Transcript Name :
Pytiw_DAOMBR242034maker-piw_contig_1228-fgenesh-gene-0.1
Orientation:
(-)
Number of Exons:
5
Description :
ATP-binding Cassette (ABC) Superfamily
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
ABC transporter-like25.457PS50893
ABC transporter type 1, transmembrane domain38.737PS50929
ABC transporter-like17.534PS50893
HmmSmart predictionP-Valprediction_id
AAA+ ATPase domain2.9SM00382
AAA+ ATPase domain0.23SM00382
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
101-480
556-639
715-782
905-1156
1-77
504-532
663-691
806-881
78-100
481-503
533-555
640-662
692-714
783-805
882-904
*** None ***
*** None ***
TypeScore
endoplasmic reticulum556
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
ATPase activityGO:0016887IEA
nucleotide bindingGO:0000166IEA
integral component of membraneGO:0016021IEA
transportGO:0006810IEA
*** None ***
*** None ***
Sequence
        5080 bases(100 bases per row)
ATGACCCACGTCACTGGCGACGAGTACGTTGAGGTGCTCACACCTCGAGGCACAGCCAACAATGGCGACCTGTCGACCAGTAAGACGACCGCGCCACCGA
AGAAGAGCACTCCGAGCAGCTCCAGCGAGAATAGCTCCACCAAAAAGAGCAACTCTAGCGATACGCCCACTGCTGTTGCGTCGATCCCGATCTCACAGCT
GTACCGCTTCGCGACACCCTTTGACCTCGCGTCCGTGGCGCTCGGGTGCGTCCTGGCGGGCGCGAACGGCGCACTCTTCCCCATGATGGCGCTCGTGTTT
GGCGACGCGATCACGGCGTTCGCGAGCGCGGACGGCGGCGTCGACAAAGCCGCGATCAACCGCGCCGCGCTCCACTACTTCNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGTGACCAACTACGGCTCGTACGTGCTC
TTCTCCAACACGGCCGAGCGCCAGATGAAGGCGCTCCGGGACGCGGCGCTCACGCACATGCTGTACTTGGACATTTCGTGGTACGACAGCAGCGACGCAC
TCCAACTCTCATCGCGGCTCACGGGCGACACGGTCAAGATCAAGGAAGGCATGGGCCACAAGCTCGGCGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGAAGCGTGCGATCGCCAAGTACAAC
GAGCGCGCGCTCGAGGCCGAGACGGAAAACATCAGCGTTGCCAAGTACTCGGCCATGACTGTCGGCGTTTTTTTTGGCAGCATCTGGGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCAAGGATGACGGCGTCATCCCCGA
GGCCTGTGCTGGCCGTATCGAGGCCATTGACATCAACTTCACGTACCCGAGTCGCCCAGATGCCCAGATTCTTAAGAACTACAGCGTGACCATCGAAAGT
GGACAGACTGTCGCCTTCGTCGGCGCCAGCGGTGGTGGCAAGAGCACACTCATAGCGTTGCTCGAGCGGTTCTACGACCCACAGAGCGGCTCGATTCTCC
TCGATGGCCGCGACATCAAGACGCTCAATGTTAAGTGGCTGCGCTCGCAGATCGGGCTGGTCTCCCAGGAACCCGTGCTCTTCGCATCGTCCATCGCCGA
CAACATTGCTGCTGGCGGCAACAACATCACCCGTGATCAGGTGATCGCGGCTGCGAAGCTGGCCAACGCGCACACGTTCATCATGTCGCTGCCGAGCAAC
TACGACACGCTGGTGGGCGAGAAGGGCGTGTCCTTGTCTGGTGGACAGAAGCAGCGCGTTGCGATTGCGCGAGCCATTGTGCGTGAACCGAAGATCCTGG
TTCTGGACGAAGCCACGAGCGCCTTGGACGCTGAGAGCGAACGCGTGGTGCAAGCGGCGCTGAACGACTTGATGGACAAGACGCAAATGACAACACTGGT
GATCGCTCACCGCCTGAGCACTGTGCGTCGTGCTGACAAGATCGTCGTGCTCTCGGGTGGCGCTGTCGTCGAAGAAGGCCCGCACGACGACCTCATCCAG
ATCGAGAGCGGCGTCTACCGCAATCTGTACACGATCCAGGAGGAGAAGGCTCAGGAAGAGGCCCAGGCCTCCGCTGCTGAGCTCGCAGGCGCTCGCAATG
GCGACACTGACGTCGAGGTCGTCCAGATGGTCCGCAAGGACAGCATCCGATCCGTCAAGAGCGACCGTGTGGCAGATGTCGAGATCGCCAACGACGTCGA
GGATCTCGTCAAGAGCGGCCGCTTCACCTTGCGTGACGCGATGGCGTTCAGCCGCCCTGAACGCAAGTACTTTATTGTGGGCATGCTCGCGGCCGGCATT
AACGGCTTCACGCTGCCGTGCTCGGCGCTCTTGATCAGTGAGATGGTGGCGACCATGACGATGAAGTATGCGAACTTCAAGGAGAGTGGCGACCGAACAT
ACCTGCACGACCTCAAGGGCGACGTGATGATCTACGGCCTCTGCTATGTTGGCGGCGCTGTGGTCATCTTCTTCGTCACGATGGTCCAGAACTTCTGNNN
NNNNNNNCATCCAGATCGAGAGCGGCGTCTACCGCAACTTGTACACGATCCAGGAGGAGAAGGCGCAGGAAGAGAAGGCCCAGGCTTCAGTTGCTGAGCA
AGCGAGCGTTCCTCATGAGACCAGCATGGTGCGCAAGTCGAGCGTTGGTTCCCTCAAGAGCCACGATCTAGACGGCGGTGATCTCGAGCTCACGACTTTA
TCAAGTCCAAGTACAATCGCTGAGCCAAAGTTCACGATCCGAGACGCGCTGAAGCTCAGTCGGCCAGAGGCCAAGTTCTTCGTCGTGGGTATGTTCTGCG
CGGCCATCTGCGGCTTCGCGCTGCCCGTGGCGGCGATCCTCATCACCGAGATGATCACGAGCATGACGTCCAAGTACGCCCAGTACGAGCGCCACGGGGA
TAAGAGCTACCTCGACTCGCTTTCGGACGACGTGACGCTCTACGGGATCTGCTACGTGGTCGCCGCGGTCGTCATCTTCGTTGCCGTGTCCGTGATGTCG
TACTGCTTCAAGTACACGGCCGAGAAGCTCACGTCCCGACTGCGCGATGTGCATTTCACGGCGCTGTGCCGCCAGGACATTGCGTTCTTCGACGAGAAGA
AGAACGCCACGGGCGCACTCACGGCCGACCTGTCCACGAACGCCACCAAGGTCGCGCTCATCTCGGGCGACGCCCAGTCGCGCATCGTCCAGGCGATCTT
CACGTTCATCGCAGCGCTCGTGATCTCGTTCACCGTGGGCAGCTGGGTACTCACACTCATCATGCTCGCCGTCTTCCCACTCTTGATCATCGGCCACGTC
ATCCAGGTCAAGCAGCTTCACGGACCCGAGGGTTTGTCGGACGAGCTCGCTGAGGTTGGCGCCCACGCATCCGAGGCACTCAGCAACATCCGCACGGTCG
CGTCGCTGGGCCTCGAAGTGAGTCTCTCGCACAAATTCTCGGCGCTGCTGGACAAGCCACTAAGAAGTGGCCGCCGCGAGGCGCAGCTCAACGGCCTCTC
GCTGGGTTTTTCGTCGTTCATCCTCTTTGCGACCTACTCGCTCGTGTTTTGGTACGGCGGCGTGCTCGTCGACAGGCGCGAGATCACGTTCAAGAACCTC
ATGAGCACGCTCATGGCGATCCTCATGTCGTCCGAGGGTGTCGGGAACGCCGCGACGTACCTCGCAGACTCGCGGAACGCGTCCAAGGCCGGCGGTGCGA
TCACTGCGATGCGAGACCGTGAGCTGGCGATCGATTCGTTCGATGAAGGCGGACTGAAGCCTGCGAAGGTGGAGGGCAAGATTGAGTTCAGGAACCTAAT
GTTCCGGTACCCGACGCGTCCAGAGGTGACTGTGCTGAAGGACTACAACCTGACCGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNCCAGGAGCCGACGCTGTTCATCGGCACGATCGCGGAGAACATCGCGTACGGCCTTGAGACCACAACGGAGGAGATCGAGGCGGCGGCCAAGATGGCAA
ACGCGCACGACTTCATCACGCAGTTCCCAGACGGGTACCTGACTCAAGTCGGCATGAAGGGTGAGCAGCTCTCTGGTGGCCAGAAGCAGCGTATCGCCAT
CGCTCGAGCGATCCTGAAGAACCCAGAGATCCTGTTGCTGGACGAAGCCACGAGTGCGTTGGACTCGGAGAGCGAGAAGATCGTGCAGGAGGCTTTGGAC
AAGGTGGTGGCGCTCAAGCGCCGCACGACGATCATCATCGCGCACAGGCTGTCGACGATTCGCAAGGCCGACAAGATCTGCGTGGTGAGCGGCGGCAAGA
TCGCCGAGCAGGGCACACACGCTGAGTTGTTGGCTCTGAACGGCATCTACACACGCCTGGTCCAGTCGGCGGCCAACTGA