Transcript Name :
Pytiw_DAOMBR242034maker-piw_contig_1187-fgenesh-gene-0.0
Orientation:
(+)
Number of Exons:
1
Description :
ATP-dependent chaperone ClpB
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
ClpA/B family1.2PR00300
ClpA/B family1.2PR00300
ClpA/B family1.2PR00300
ClpA/B family1.2PR00300
*** None ***
HmmSmart predictionP-Valprediction_id
AAA+ ATPase domain3.8SM00382
Clp ATPase, C-terminal2.9SM01086
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Clp ATPase, C-terminalIPR019489
*** None ***
InsideOutsideTMhelix
1-580
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
nucleotide bindingGO:0000166IEA
*** None ***
*** None ***
Sequence
        1743 bases(100 bases per row)
ATGCTCAAGCCGGCGCTCGCGCGCGGCGCGCTGCACTGCATGGGCGCGACGACGCTGGATGAGTACCGAAAGTACATTGAGAAGGACGCGGCGCTCGCAA
GACGCTTCCAGTCCGTGCTCGTGCCCGAGCCAAGCGTTGAGGATACGATCACGATCCTCCGCGGGCTCAAGGAGAAGTACGAAGTGCACCACGGTGTGCG
CATCTCAGACAACGCGCTCGTAGCCGCGGCGACCCTCGCGAACCGGTACCTGACCGAGCGCAAGATGCCCGACAAAGCCATCGACCTCATGGACGAGGCG
GCCTCGCGATTGCGGCTCCAGCAAGAGAGCAAGCCCGAGCCGATCGACAAGCTGGACCGCGAGATTATCCTGCGCCGCATCGAGATCGAGGCGCTGCGCA
AGGAGACAGACGCGGCATCTAAGAAGCGCATGGCGCAGCTCGAGCGCGAGGTTGAGAAAGCGTCCAAGGAGCTGCGCGTGCTCCTGGACGAATGGAACGC
CGAAAAGGAGAAGCTCGAGGCCATGCAGGAGGCCAAGCGCCGGCTCGAAGAGGCACGACGCGAGCTCGTCGCGGCGCAGAACAACGGCAACTATGGCCGT
GCGGGCGAGCTCCTGCACGCGATCATCCCCAAGCTCGAGCTACAAGTCGCTGAGGAAGAAGAGAAAGAGGTCAGTGGCGATGGTGAGCACGACCCCAAGC
TCAAGTCCAGTCTCGGCGACGCTGTCACGGCCGACCACGTGGCCGAGGTCGTCGCGCAGGCCACGGGCATCCCTGCGTCGACTCTCATGTCGGGCGAGAA
GCAACGGCTGCTGCACATGGAGGAGCACCTGAACAAGCGCGTGATCGGCCAGCAGGACGCCGTGCAGGCGGTCAGCAATTGCGTGCGGCTCGCTCGCGCA
GGGCTTCACGCGCACAACCGTCCATTGGGCGTGTTCATGTTCCTCGGCCCCACTGGTGTGGGCAAGACGGAGCTGACCAAGTCGCTGTCCGAGTTCCTCT
TCCAGAGTCCGCAGGCGCTCACGCGCATGGACATGTCCGAGTACATGGAAAAGTTCAGCGTGAGTCGCCTCGTTGGCGCGCCGCCGGGTTACGTGGGCTA
CGAAGAAGGCGGGACGCTCACCGAGGCTGTGCGGCGCCGACCGTACCAGGTGGTGCTCTTCGATGAGTTTGAGAAGGCGCACCGCGACGTATCCAACATC
CTGCTGCAGGTGCTGGACGAAGGCCGGCTGACAGACTCGCAGGGCCGCCTCGTGGACTTCCGCAACACGGTCGTGATACTCACGAGCAACCTGGGCTCCG
AGATCCTAGCCAGCCTCCCTGAGGGCGTGCCCAGCTCGGCGGCCGAGGCGGACGTGCTGCGCGTCGTGCGCGGCCACTACGCGCCCGAGTTCCTCAACCG
CATCGACGAGCTCGTGCTCTTCAACCGACTGGACCGCGACGCGACGCGCTCGATCGTGGACCTGCAGTTGCACCAGGTGGACCAGATGCTCGAGGAGAAG
GAGATTCAGGTCAAGATCGACGCGGACGCCAAGGATTGGCTCGCAGCCACGGGTTACAGTCCGCTCTACGGCGCCCGCCCGCTCAAGCGCCTGATCCAGC
ACGAGCTGCTCAACCCCATGGCGATCAAGCTGTTGGACGGATCGATCGGTCCAGGCCACAACATCCGCGTCAAGATGAACCCGCGCTATGACGAGGAGCT
GCTGCGGGACCCGCGACGAGCCAAGCCTCTCATTGTCGAGTGA