Transcript Name :
Pytiw_DAOMBR242034maker-piw_contig_1111-fgenesh-gene-0.0
Orientation:
(+)
Number of Exons:
5
Description :
DEAD/DEAH box RNA helicase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
RNA helicase, DEAD-box type, Q motif7.89PS51195
Helicase, superfamily 1/2, ATP-binding domain28.975PS51192
Helicase, C-terminal22.25PS51194
HmmSmart predictionP-Valprediction_id
Helicase, superfamily 1/2, ATP-binding domain3.5SM00487
Helicase, C-terminal9.9SM00490
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Helicase, superfamily 1/2, ATP-binding domainIPR014001
RNA helicase, DEAD-box type, Q motifIPR014014
*** None ***
InsideOutsideTMhelix
1-702
*** None ***
PositionContextScore
150KQQRRAR|AA0.554
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
nucleic acid bindingGO:0003676IEA
helicase activityGO:0004386IEA
*** None ***
*** None ***
Sequence
        2549 bases(100 bases per row)
ATGGCGAGCAGCTTCTTCGGCGCGCTCACGCAGGGTGCCAAGTTCGACAAGAAGCGCTTCCAGCAGCAGATCGGACTCTTCAGGAAGCACGACGGTATGT
GTGAACTATCATCTCTCGCTTATTACCGCACTGCTCGTAGTGCTGGAGCTCTTGAGAGCACGAAGAGCTACGTATTGACTTGTGAACCAACCTTTGTGGA
GCAGACTCGAACAAGAAGCGCGCGAACGCGAATGCAAGCGAGCTGGACTTCTTCGGCTGTGATGCCGCTGCTGCAGCTGCTGTCGTGAAGAAGCCCGTGG
AGAAGAAGCCCAAGCAGCGCGAGCGCAAGATGAGCGTCGACATGGTGCCCAAGTGGGCGGGCAATGAGGACGCGGCTGCGAGTGGCGGCAAGAAGAAAAC
CGGCAGCAAGCAGAGCCGCAAGCGCAAGCTAAGCGAAGGTGCGATCGAGGAGCAGAAGCTCGAGGATGACGAGCGCAAGCAGGCGTCGCTGCTGCTTGCG
CCGCCCAAGATGAACAAGGCGCAGAAGCGCAAGCTCAAGAAGCAGCAGCGCCGAGCGCGCGCGGCCTCGATCGGTACGTTTGTGACTACTGCCCTTATTT
ATATACGTTTGGGAAAGTTAAGTACACATGAGCTGGCAGATACTGATTCTTATATGTTGCTGTTTCTTCAAATGCAGGAAGCGAAGCCTCGTCCAGAGGA
GACGAAGAGAGTGATGAGAGTGAAGAAGAGGACGATGAAGAGGACGATGGTGATGAAGACATGACGCTCTTCAGAAACGACAATGAGGATGACGACGAGA
CCGACGGCAAGACGAAGAAGAGCAAGAAAGTTGCAAAGCAGGAGGCCGCGGCCAGCAAGGAAAAGTACGTACTTATTTACCACTTTCTGGCTACTCACCA
ATGCACAGAGCTCATGGCCTTGCTTGATAAGCGTCGCATACTAACTTGCTGTCTGTATTTTGCCTGTGTCTCTATCCCTTGCTAGAGACGAGATCATGCA
ATTTCGTCGCCAAATGAACATTCGCGTCGAAGGCACAGTGGTGCCAGCGCCGATCGCCGAGTTTACGCTCATGCGCTTGAACGCGCGCCAGGAGAAGATG
AAGGACGTTCTGCTCAAGAACATCGAGGCCTCGGAGTACAAGGAGCCGACACCGATCCAGATGCAGGCGATCCCGAGCATGCTTCTGGGCCGCGATGTAC
TCGCGACCGCGCCAACGGGCTCTGGAAAGACCGCCGCCTTTGCAATCCCAATGCTCGCCAACCTGGGCGCGCCCGGACAGGAGCGCGGCATCCGTGCGAT
TGTGCTCTCGCCCACGCGCGAGCTCTCGGTCCAGATCCACGCCGAGTTCAACCGCCTGAGCAAGGGCCGCAAGTTCCACATCGTGCTGCTCTCCAAGGCC
ACGGCAGCCACGATCACGGCGCAAATTAAGTACGTTCCTTTTCTTCATTTGCCCTAAAATCGTTGTGAGCATTGTGCTTGGTGCTAACATTGTCATTGGT
GCGTACTTACTTATCGAACAATCATTCTTTGTAGGAGCAAGTGTACCGTGAATCACGACATTGTGATCGCGACGCCGCTACGCCTCGTGCACCTGATCCA
AGAGACGAAACTCGACCTCTCGACGGTCGAGACGGTGTGCCTAGACGAGGCCGACCGGCTCTTCGACATGGGATTTGTCGAGCAGATCGACGAAGTCTTC
GCGGCGTGCACGCATCCAAAGATCCAGCGCGCGATGTTCAGCGCCACGATGCTCCAGGGCGTCGAGGAGATGGCGCAGTCCGTGCTGCGCGATCCGGTCA
AGGTCTCGATCGGCGTCAAGAACTCTGGCGCGACGACTATTGAGCAGAAGCTCGTGTTTGTCGGCAAGGAGGAAGGCAAGCTCGTGGCCATGAAGCAGCT
CATCACCGAGGGTCTTCGTGTGCCGGCGCTGCTCTTTGTGCAGAACAAGGAGCGCGCAAACGAGCTCTACCAGGAGCTACTCTACGATGGCATCAACGTG
GGCGCTGTCCATGCCGACCGGACGAAAGAGCAGCGCGACGACGTGATCAGGCAGTTCCGCACGGGCGCCATCTGGGTGCTCATCTGCACGGACCTCATGA
GTCGCGGCATGGACTTCAAGGCCGTCAACATGGTGATCAACTACGACTTCCCGCAGAGCGCCGTGAGCTACATCCACCGCATCGGGCGCACGGGCCGAGG
CGGCCGCCAGGGGCTCGCGGTCACGTTCTTCACCGAGGACGACATGATGTACCTGCGTGCGATCGCGAACGTGATGAAGCTCTCGGGCTGCGACGTGCCC
GAGTGGATGCTCGCGCTGCGCAAGACGAGCGACCGCGCGCGCAAGGAGCTGCTCAAGGCCCCTCCGCAGCGCCACCGCATCAACACGGTCTCGGGCTACG
ATCTGCAAAAGTCCAACCGCATGCGCCAGTTCAAGAAGGGAGCACCGGGCGATGAAGAGGACGGAGCGCAGCAGCAGAAGAAGAAGAGCAAATTCCCAGA
GGGTGGGAGCAAGAAGAAGCCGAGTGGGCCTGGGAAGAAGACTGAGTAG