Transcript Name :
Pytiw_DAOMBR242034maker-piw_contig_1073-snap-gene-0.5
Orientation:
(-)
Number of Exons:
1
Description :
Glycoside-Pentoside-Hexuronide (GPH):Cation Symporter Family
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
141-152
208-227
278-304
398-427
514-520
1-117
171-184
251-254
328-374
451-490
118-140
153-170
185-207
228-250
255-277
305-327
375-397
428-450
491-513
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1563 bases(100 bases per row)
ATGGCGTTCGGTCTCCAACTGTCACTCGCAGCTCACTCTCCAACACGCGTCCAAGTCCCGACTCCAGCATTTCCACCCGACCAATTTTTCGCTATGACCC
ACGAGCGTGAGCACCAAGGCACGCCCTTGTACGACCGCGTGGACTCGCCTCCGGCCAAGAGCGACTCGGTCGTGCTCGTCCAGGACGGCCTCCTTCTCCA
AGACACCGTTGACGGCGGTGCGTCGCGTCGCGGCTGCTCGGTCGCCATGCTCGTGCTGCTCTCGCTGCCGCGGATGGCCACCAACATGGCCTGGGCGGCG
CAATGGGCCGCCTTGGGGCCGTACCTGGGCACGATGCTGCCACCGTACGCCGTGCAGCTCACGCAGGTCATCGGTCCGCTCTCGGGCATCCTCGTAGCGC
CGACGATCGGCGTGCTGAGCGACCGCAGCACGAACCGCTGGGGCCGCCGTCGTCCATACCTGCTCTACGGCGCGATCACGAGCGCAATCTGCTGGACCAT
GATGGGCTACACGCGCAAGCTCGGCGAGTTACTGGGCGACAAGGACGACGAGAGCCGCCTCTGGACGTCGCTGCTCACGATCTTCTTCTACACGTGGATG
GACGTCACGGTCAACGTCGTGCAGACGCCCGCGATCTTGATCATCGCCGACTTTGCCGGCGACCGACAGACACTCGGCGCGGGCATTGGTCAGGCGAGCT
CGACGCTCGGCTCCATCATGATCGCCGGGTACATCTACTGCTTTGGCGCGGCCCACCTCACGCTGCGCTGGTTCCTGGGTATGCTCTCGGTTACGATGGT
CACGACTGTGGGCGCCGTGTGCCTCTTCGCCAAGGAGATACCGCGCGCCAAGGACCCGCAGGATGACCTCGTGACGACCTACCGACGCATCGTGCACGCG
TTTGGCACTATCATCCACGGCCTCCGGACGCTTCCGAGCGTGCTCGTGGTCTACTGCGTCGTGTTCTTCACGGTCCAGTACGGCTTCACGGCCTACAACG
GCAGTAAGGGTCAGTTCTTCGGCGTCGAGGTCTTCCACGGTGACGCGAACAACGCCGACACGTGCAAGCTGCACTGCTCGCATGAACAGCAGCAGTACAA
CAAAGGCGTGCAGCTCGCGGGAGGACTCGCCGACATGGTCTTCAACATCGTTGGCTACGTCTACTCGTGGGTGCTACCGTTCCTGGTCTGCCGCCTGGGC
GCGCGCTGGACCATGACGCTGGGCGGGATCCCGCAGACGCTGCTCATGGCCATGGCGTTCTCCAAGTCCGTGCCGCTCAACGTCGTCATCGTCGCGCTCA
CATCCATCACGCAGGCCACGAGCTTCGCGCTCATCGTGCCGCTCCTGATCCACGTCTTTGGCGATGGCGCCGAGGTCGGCATGCACGTGGGCGCTGTGAA
CTCGGCCAACTGCCTCGGCCAGCTGCTCAACTTTGTTGCGAGCGCCGCGCTCGTCGAGACGGCGCTCGGATACGCGCTCCCAGTGTTCGTTGGCGGCGCG
ATCTCGTTCCTCGGAGTCATCATCAGCCTCTTCTTCTTCCGGGTCAAGATGTACTCCATGTAG