Transcript Name :
Pytiw_DAOMBR242034maker-piw_contig_1025-snap-gene-0.6
Orientation:
(-)
Number of Exons:
2
Description :
Protein kinase
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.5320.64636
InsideOutsideTMhelix
341-369
1-317
318-340
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2540 bases(100 bases per row)
ATGCCGCGCGCTGCTGTTACAAGTGCCCACCTGCTGCTACGATCGTGTTATATCTGTTGCTGCTGGCTCGCGCTCGTACTACATGCTGCAGTGCGTGTCG
ACGCGGTGATCGACGTCGTCGCGCAGCTGCACCACCTCCAGCAGCACCAAGCCGCCGCCTCCTCAGCGCCAGCAACAGCACTGCCAGCAGAGAAGATCGT
GCTGCAGAACCTCCCAGGCGCGCTCTCGAGGCGCCTCACAGAGCGGAGACTGCGCTGGACGGACCTATCAGCGCTCGAGCAGCGCGCGCTGCTCTGGGAC
ACGGGGCTCGTGCTCACAGCCGAGGGCAAACTCGTGCAGGTCTTCGTGCCCTGCGGCAAGACCATGAGCCAGCTCTTCCTCTCGAGACAGATGTTCGAAG
GCAACAAGAAGGCGTGTGAAGTGAAGATGTGTGCGGCGAACGAGCGCGTGCGCTTTGCGAGCGCCAACTGCTCCGTCGCAGCCGTGCAGCGCGTCGCGCA
GTGTGCGATCGAAGACGAGGGCGTCGTCGCAATGACTTCAAGCAACTCGCTCTGGTCCGAAGATGGGGAGATAGCGAGCGTCCCGGACATCCGCGTGTAC
AGGTACGAGGCTTCGACATCACGTACGAGTGAGTTCAACAGCAGCAGCAACAGTGGTAGTAGCGGTGACAAAGTCCATGTGAATGCCAAGAACGAGTCGT
CCACGCCAGTCCTGTTCACGATCAATGAGCGAACAGTCCAACTGGATCCAGACTCTGTCGACGGGTGCTCCGTCAGCGAACCATTCTTCATCGTGCCGTG
CATACAACGAGTGGTGGCGAACCGAAACTCGTGGTGCGCGCCAGAGCGCGGCGGGTATTTGGACTTCTGGCTCGACACGGAGATGTATGCGAATCCGAAC
ATTGTTGTCACGAGGGCGAGCACGTCGTCGTCTGGGATGTCGGCCTCCAGCATCGTGCTGATCGTGCTCTTATCGGTAGTGGCGGCGGTGACTGGCGCGT
ACATCGCTGCGCGGCTCTCCAGGACGAGGACGGAACCACGTCGAGCCAAAGGCATGACGATGGCCACGACACCAGCGGGCAGCGAACGTGCGTCGTCGGC
AGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTAGCCGCC
GCCGAGTACCGCCAATCACTCCCAGCCATGCTGAGCTACCCGTCACAGTCGCAGCTGAGCGGGATAGTGATGGTGAATGGCGGTGATGGGGCAGCGCTCA
GTTGTAGTAACCCTGATGACGATGCGAGCGACATTGCGGCGCTGAACGAGTCGATCTTCCGGCGCTCGATCGAAATGTCGACCTTCTGCGCCGACAAGAC
GTTGATGGCGAAGCGCATCCAGTACCACGAGATCACATTCGAGAAGATGCTCGCACGCGGGGCGAACGGCGAAGTGTGGAAGGGCGAGGTCGGCGGCCAA
GTGGTCGCGATCAAGCAACTGCTACAGGAGAAGCGCCACGACAAGAACGCGATCGAACAGTTCGCCAAGGAGATCCGGCTCGCGTCGCGACTCGAGCACT
TAAACATTGTCAAATTCGTCGGCTTCTCCTGGAAGGGACTCTCGGATCTCTGTTCAGTCTCGGAATTCATGGGCAAGGGCGATCTTTCGGACCTCATCAA
CTCGACGCTCAGTGGCCGCATGACCTGGAACCAGGAGAAACTCTCGATCGCGATCGACATTGCGAACGCGCTCGTGTACCTGCACTCTCTCGAGCCGCTG
ATCATCCACCGTGACCTCAAGTCCTTCAACGTGCTGCTAAACGACAACCTCCAGGCCAAGCTGAGCGACTTTGGGCTCAGTCGGACACGATCCTTTGAAG
AGACGATGACTTGCGGTATCGGCACACTGCTCTGGACCGCGCCCGAAATCCTGCGCGGTGAGGCGTATACGGAGAAGGCCGACATCTTCTCCTACGGCAT
CGTGCTCTCGGAGCTCGACACATGCTTGCCGCCGTACGCGCTCAACGAAGAAGTGAGCAAGCAGCAGCTCACCAACATGCAGCTGATCAACCTGGTCGCG
AAAGGCCGGCTCAAGCCACGGTTCCGAGGCGACTGCCCCGTCGCGCTCGAGCGCCTCGCCACCTCGTGTGTTGCTGCGGACCCGGCGAAGCGGCCGAACG
CGATGCAGATCGTACTCGCGCTCACATCGAAAGTCATCTCGTCATACATGTGCAAGAGTTGACCGAGGGTTCTACATGGACGAGCTGAACCCTCGACTCC
TACCTCCCAGAACGCAAGCGAAGTCAAACGGATGACAAGCGGAATCAGAGCCGCGGAGCTTGGGAGATTTTCGAACCTGGGCTTCGCAGACTTCTTCTGT
TTGGTGTGGATGCTGAGACTCCAATATCCGCACCAGATAA