Transcript Name :
Pytiw_DAOMBR242034maker-piw_contig_1013-snap-gene-0.2
Orientation:
(+)
Number of Exons:
2
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-104
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        584 bases(100 bases per row)
CAAACGATGCTACAACGCTGAGCGCAAGAGCGCGTTCGTCAGCTCAAGAGTGACCGACGCCAGAAGAACGAGAATCGCCTGGCACAATGACGGCCCGACC
CCCGAGGTGAGCTCCTTAAGCTACTTGATGGGCTGGATTACCTTTGGGGCGAACTACAGCAGATACCAGGGCGGTGATGGACAGCACGGCGAGACAAANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNGCCACGGCCCGTTCCTAAAGACATCCAGCCGAAGATCAAGCCTCCGGAGCACTCGTACAAGACAGCGGCCGACTGGCT
GAAACACACGGGGCAAGGAATTGCTGAAGAAGGAAGCTTGCATGGCGGCATTTTGAAACGATGTCTTCATTATTACGAGCCCTA