Transcript Name :
Pytiw_DAOMBR242034maker-piw_contig_849-snap-gene-0.11
Orientation:
(+)
Number of Exons:
1
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
WW domain11.329PS50020
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-267
*** None ***
PositionContextScore
224KPSRERR|RR0.538
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        804 bases(100 bases per row)
ATGAGCAACCTCGCGGTCGTGGTGTCGAAGCAGCGGTCGGCCGAGACGTTTGCAGAGGTGTGCAAGATCCAGCACCTGCTCGCCAAGGACTTTGAGCGCC
ACGACGGCCGCCAGGAGCTCTTCAAGCTGCAGTTCCTGCGCGAGACGCGCAAACACCATCAGTGCATCTGCGAGGCAGCGTGTGCGGCGACCAGTTCAAT
GTCTGCCGCTGCGGCGTCCGCACTGCTGCTGGCGCAGCACGACGTGTTGTCAATGAACCGCGGCGGCGGATCTACAGCGAACGACCCAACGCTCGAGCAA
AGCAGCAGCGACACGGAAGCCGAGCGGAGGGTTAAAGCTCAGCTCAAGCAGCTACGCTCGTCCAGCGAGTCGAGCCAGACGCACATCTGGAACGGACTCA
AGAACCTGTACACCCCGCCAGACGTGACGACAGGGGTCATCTGCGACGTGTGCTTTGCCTTCAGGAGCGCGTCGCTCGTACTTGATTTGCCATCTCCATG
GCAGGAGTTCACATGTGAGAACGAGCCAAGCAAACACTATTATTACCACCCACAGACCAGGAAGGTACTCTGGCGCCCGCCGGTCGACACGGGCGTGCTT
AGTCTGCTCGTCTTCGAACGCACCAACTCAGTGTTCACTGTGTGCCACTGCAAGCCCTCGCGCGAGCGCCGACGCCGGCTGATGCAGAATTTCCGAGACC
ACGCGCTGCAGACCGCGGCCGCCGAGAGCGCGAAGAGAGATCGACAGCTACGTGGGGCCTTCAGCTCACTCGCGATCTCCATACTCAAGATAAAGCCCCA
GTAA