Transcript Name :
Pytiw_DAOMBR242034snap_masked-piw_contig_529-abinit-gene-0.27
Orientation:
(+)
Number of Exons:
2
Description :
Phosphoglycerate mutase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Histidine phosphatase superfamily, clade-12.1SM00855
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Histidine phosphatase superfamily, clade-1IPR013078
*** None ***
InsideOutsideTMhelix
1-260
*** None ***
*** None ***
TypeScore
cytoplasmic652
GO
*** None ***
KO ID
K01834
K01834
K01834
K01834
K01834
*** None ***
Sequence
        1002 bases(100 bases per row)
ATGGCTGGTGCGTTGCTCTCTGTGTGTCTGTGTGTGTATGAAGGAGCGAATGCCACCGCCACCGCATGCTCCTCTTCCCCACGCGCTCGATGGCACGTCT
GTTGTTGCACGCAACGGGGAGCGTGAGGCGTCTCTTTGTGCTGCACGAGTAGCTCTGAAAACAAATCTTTTTTTTTTTGCACGTGCTCACCTCTGTGTGT
GTGTGCTACGAATGGTCTTAATGCAGCCAAGTACCAGATCGTGCTGATCCGCCACGGCGAGAGCCAGTGGAACGTGGACAACCGCTTCACGGGCTGGGAG
GACGTGCCGCTCTCGGCTACGGGCGAGAAGGAGTCGCACGACGCCGGCAAGGTGCTCCAGGCCGCCGGCTTCAAGTTCGACGTGGCGTTCACGTCCGTGC
TCAAGCGCGCGATCAAGACGCTCTGGAACATCCTCGAGGAGACGGACCTCATGTGGATCCCCGTGGTGCGCTCCTGGCGCCTGAACGAGCGCCACTACGG
CGCGCTCACGGGCCTCAACAAGCAGGAGACCGTCGAGAAACACGGCCTCGAGCAGGTCATGGTCTGGCGCCGCAGCTACGCGATCCCGCCGCCGCCCCTC
GACGCCGCGAGCCCGTACTACCCGGGCAACGACGCCAAGTACCACGACGTGCCCAAGGAGCTCCTGCCCTTCGCCGAATCGCTCGCGACCACTGGCGAGC
GCGTGCTGCCGTACTGGGAGCAAACGATCATCCCGGCTATCCAGAGCGGCAAGAAGATCATCATCGCGGCGCATGGCAACAGCCTGCGCGCGCTCGTCAA
GCACCTGGACAATATCCCAGAGGACACGATCACGGGCCTTAACATCCCCACGGGCGTGCCCCTCGTGTATGACCTGGACGAGAACTTCAAGCCTGTGCCG
CACGCCGACGCCATCGCGCCGCTCACCGGCCGCTACGTCGGCAACCAGGAGGAAATCAAGGCGCGCATCGCCGGCGTCGCCAACCAGACCAAGGCCCACT
AG