Transcript Name :
Pytiw_DAOMBR242034maker-piw_contig_281-fgenesh-gene-0.3
Orientation:
(+)
Number of Exons:
2
Description :
Guanine nucleotide exchange factor
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Pleckstrin homology domain9.896PS50003
Guanine-nucleotide dissociation stimulator CDC2524.232PS50009
HmmSmart predictionP-Valprediction_id
Pleckstrin homology domain0.0027SM00233
Guanine-nucleotide dissociation stimulator CDC256.6SM00147
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Pleckstrin homology domainIPR001849
*** None ***
InsideOutsideTMhelix
1-1019
*** None ***
PositionContextScore
313SHCRLRR|FS0.677
*** None ***
GO
Biological ProcessGO IDPrediction Method
guanyl-nucleotide exchange factor activityGO:0005085IEA
intracellularGO:0005622IEA
small GTPase mediated signal transductionGO:0007264IEA
*** None ***
*** None ***
Sequence
        3124 bases(100 bases per row)
ATGAACGACACGATCAAAGAGGGCGCTGTGGCCGTGCGCAGCCACTTCCTGGTACGCTTGTTCAGACTTGATAGTTTGTTTGTGTGCTTGCTCACTTGTT
TGCTTGACCTGCTAGTGGCGCGAGCGCTTCGTAGTGGTCCGGAAGGGCGAGGTGCTCATCTTCCGGCGGCGCGATGGCTCCATGAAGAACCGCATCGACC
TGCTGCACGCGAGCGTCAAGCTCACGTTCCACAGCGACAACGCGCATGTCACGGTCGCGCACGCGAGCAGCAGCGGCAAGGATTGCATCCTGGACTGCCA
CACGACCCAGGCGCGCGACTCGTGGCTCAGCGCGCTCGTCACGGCGCGTGGGCGTCTCGAGGTGGACACCGAGTCGGACGTGATCCTCTCGGGGGACGAC
AGCGACGACGACCTCCCACTTCTCCACGAGGAGGACGCTATTGTCCACCTGAGTGCGACGACGAACACCAAAGCTGAGCTCAATGGTGATAACGAGACCG
AGGACGACGACGAGTACAGCGAAGCCTTGTTGGCGTTCCAGGACGTGCGCACGTCCATGATCGCGGCCCACTTGACCATGAGCACGGCCAAGGAGGACCT
GTTCGTGGCCCCCGATGCGTCACTCCAGCGCAAGCACCACCACATCCACGCGACACGCGCCGAGGAGCTCGCGCGGCTCAAGTGCATCCGGTCGATCCTG
CTCTTCATCGAGAGTGTGCCCCACGGCGGCCGCGTCATCCTGCTGCACCTCGGCGTGCTCGCCTCGGCGGGGATCAAGATCGACGACATCCTGCTGGCGC
TCGGCGAGAAGCAGCAGAGCGGGACCCCGCGGCGCTCGAGTCTCACGGCCACGACGGCAACCATCTCGATGCACAAGCTCTGCGCCGCGACCTTTGTGCG
CGACATGATCTTCCACCCGATCTACAGCCAGCGACCCGAGGTTAAGAGTGAGCAGGTCAACGGCCTCATCGACCGCTTCTTCTCGCACTGCAGGCTGCGA
CGCTTCAGCCACGACGACGAGCACATGATGATGATGAGCTCCGTGCATCCGGTCGGCCTCGGTCTCGACCTGGCCGCCACCAAGGCGCTCATGCTGGACG
GCGCTGGTGGTGGCGCTAGTGGTACGACCAGTGCGACCCGCAAGACGCAGCCACACACAGTCACCACGCTGATGAACCGCGCCGAGATGCTGCTCAAGAA
GAAGCGCCACTCATTTCCCAACATCCTCACGCCTCTGCGTGCGCGAACGGGTCTACTGGACACGGCCAAGCTCGAAGAGCTCTTGAAGAAAGGCGGCGGC
GGCGGAGTTTCTTGCAACAGCACGCCAAAGCCCAAGACTCGCTCGTCCGTCCCGACAGCAAACCCAGCCAAGGCTTCTTCTTGCCCCACAGAAGGGAGTG
GTGACAAGGACGACGACCTGGCCATGCTGGAGAACCGCAAGACGTCCATCTCCTCGACAGACTCGGACCTGTTCCGGGACGAGAGCATCCCCGAACCGCT
CCAAAGTCTGCTGTGGCGCAACTCGTGCCAGGAAGTGGCGGAACAGATCACGCTCTTCCACCACTCGCAACTCGCGAGGCTCTGCCTCTGGGACTTTTTG
CACAACCCGCGCGAGGCCGCCAAGGAGATCTCGGAAAGCTTCAACCGACTCGTGTGCTACCTGGTCTGGTCCGTGTTGGTTGAGGACTCCCCGAAGGACC
GTGCCGAGGTGATCGAGAGCATCATCTCGCTGGCACTCGCGGCTTGTGGCATGGCGCTCAACAATTTCCACCTCGTGATGGCCTGCGTGGGCTGCCTGGG
AGACACGCCGCTCATGGTCTCCAGACTGCCACTCACGTGGAAGAAAGTGCGGTCCAAGTTCAAAACCCACCTGCGCGAGCTGCGCACGCTCTGCGACCAC
TCCGGCGGCTTTGAAAATCTGCGCAAGCGCCAGGCCTTGCTGAGCGCCAAGTGTTGCTGCGTGCCCTTCATCGGTGTCATTGGCGTCTCGCTCGAGCGGC
TCCGAGCGACGAATTACTTTACGGATAACGATCGCAAGCAGTTGCTCGACTTTGAGAAGCTCGAGCGCCAGTACGTGACGCTCTCTGTGCTCGAGAACGG
GATCCAACGACCCTACAAGACGCTCCGGGCCGTTGAGCAGGTCCACACTTTCCTAACGACGCTGGCCATGGAGTTTGCGACACCAAGGCTGTTGCAACTG
AGGTCGCAGCAGATCCTAGCGCTTGAAAGTAATGCCTCGGGCTTAGCTTCGTCCAGGCACACATCGTTCTTGCAGCCGCCATTATCTTCCGGCTCGTCAT
CAGGCTGTGCGGCAAACTCAGGACCTTCATCAGGTGAGACCGGGGACATCAGCAATGGGTCAGGCTCATTTCTGTCGTTCCGTTGCATCTGCAGCACGCT
CGTGACTGTACCACACAGCAGCGAACGTCTCCAGATTGGGCTCGAGGCGCTCTTCGCGGACGACAGACAGCCGCTCACACGGCCGCTGCGACGGTTCTGG
CTCGACTTCAAGACCAATGTGTGGGTGAGCGCGTGCCACTTCTGCGTCCAGGGCGCGCGCTCGTGTGTCGATGCGCTGTTTCGCGACGTGCTGGTGACCA
AAGCCACCGAGCTGCAGCAGCTTAGCGGGCTCGACGAGAACAGTGCAGGATTCCACCAGGTCGTCTACAGTACTCTGGTGCGCCTTGTGACGCAACCGAT
CTTCACGCTCTTGTTCGCCAAGGTCAAGCACACGTTTGCGAGTGAGGACGCCAAGATGACCGCGTTCGTTGCCGAGGACCGCGACCACGAGCCATTGTTG
CAGCACCAGCCGCAGTCGTTCCGGTGGCTGAGCACCATGCAGCAGCATAGCTACTTGTCGTCACCGTTGGAGCTCGTCGCCTGGATTTCAAGGCACACAA
CGAGCGAGAGCTTAGTTGCGAATGAGCCGACAGCAATGACGAGAGCACTGCTGACACAGCTCTGCAGGAGTGACAAGCAACTTGGGGCGCACCTTTTCAG
CGTTTTGTACGCGCTGCAGCAGCTTCTGGACGTTGCACTCCTGCCACGAACACAGAGAGAAGCGATTGAACTGCTGGCGCAGGCCATTGCACACGTGCAG
ACGGCGACAACGCAGCAAAGTTGA