Transcript Name :
Pytiw_DAOMBR242034maker-piw_contig_254-fgenesh-gene-0.3
Orientation:
(-)
Number of Exons:
2
Description :
40 kDa peptidyl-prolyl cis-trans isomerase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Tetratricopeptide repeat8.024PS50005
Tetratricopeptide repeat-containing domain8.789PS50293
HmmSmart predictionP-Valprediction_id
Tetratricopeptide repeat330SM00028
Tetratricopeptide repeat17SM00028
Tetratricopeptide repeat0.088SM00028
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-662
*** None ***
PositionContextScore
531SKARFRR|AQ0.572
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        2228 bases(100 bases per row)
ATGAGCGACGTGCGCTCGCTCAGCAGCTCGCCGTCGTCGTCCAAGTCCAACTCGTCGTCGCTCGGTAACTCCATGATGTGGGAGCGCGTGTCGCTCTCGC
CGTACGAGGTGGTAGCGATCCAGCTCGAGAGCGAGCTGCAGCACGCGACAGAGTCGTTCGTGACGCCAAAGCAGAACAAGAACGGCGTCGATCTCAATAA
GACCACGGGAAAGGCCGCCGGTCGCGTGCGTGTGGAGGTCGTGGGAGCGGAAGGGCTCACCGATGTGCTCGCGCAGAATCCGGTGCTCGGCAACGCATCC
TCGCAAGAGCCTGCGCTGTATGTGTCGACGATGGTGTCGCCGCTGTCTGCGTTCGAGAAGTCCACGAAGAAGCACCTGCGCACTGCTGCCGTGCCGTTCG
ACTCGAGCAAAGGACGCGCGTATTGGAACGAAACGCTGGTGTACGATGGCGTCAAGGCGAAGAGCTTCTCGATCAAGCTCTGCGTGCAAAGCAGCGTTGG
CATCATCGCCGACATCGTACTGGGAGAAGTGGAGATCAGCAGCAGCGACTTCTTGGACCAGCACACACACGAGAAGTGGATCAGCCTCAAGACCCCAGTG
TCTGCGCACGCTCTCTCATCGACTGCTGAAGGCAAAGTGCTGGTGCGAATCACGTTTGAGTACAACTCTGTGGAGCTGCACGAGCGCAAGATCGCCGCGT
TGGAGCTAAGGAAGAAGGAGAACGACGAGAGCAGCGAGCACTTCCGAAAGACTGCGGCCGTGCTCCAAGCGCAAGCTCAGCACCCAGCTGCGTTTGGCAC
TGCTACCGCCAAGGCCGGTCTGTACATTCCAGGAAACCAGTTCCAAGTGGACGCGCACCACCCAGGCGCAGTGAGCGTGACCCCGCTGCCGGACAAAAGT
CGCATCGTGACGCCATTCGGGCGCGGTGTTGTCATCTCGTTCCGCAAGGAGACGAAGATGTACGTTGTCCAGCTGGACACAGACTCTGCTGCGAAGAACC
CGACGCTCGCGTACCTGCGTCAAGAGGCTGTGCGCGAGGAGCCGAATGAGCCCCACCTGCGCATGCACATGAAGGTCTCGACTCCGTATGGCGAAGGTTT
GATTGACGAGATTCGTCCGCACGACGAAGTGGTGATCGTCAAGACCGAGTACGCCCGTCTGTTTATGCAGAAGAAGGACGTCAAGATCCCAGAGAAGTCC
ATCGAAGAGATGAAGACGAAAGATCTCATCGCCGAGTCCATTGCGCTGGCAGACACTGGTAACGAGCAGTTCCGCAATAACAGTCTCGAAGACGCTATCT
ACAGCTACCTGCGATCGCTCGGCTACTTGCAGCGTGTCGATCAGGATGGTGCCACCCACAAGGAGAAGGCGACGATGCTCCAAACCATGATCCGCTGCCA
CCTAAACATCGGCGCGTGCAAGCTCAAGCTGGACGCGTACTACGATGCTGAAGTTGCGTGCACCAATGCGCTGAGCATCTTGACGGTGCTTGGTGAAAAC
CGCCATGGCAACGTTGTCACGTGGATGGGCAGAATCGGTCTCAGCGACCAGGTGTTGTTCGAAGAGTGGCCATCGAAAGCGCGTTTCCGCCGTGCACAGG
CGACGTTCAAGCTCGGCAAGTACAGCGACGCAAAGCAGGACCTGATCATCGCCGTGAAGCTCACACCCAAGGACAAGTCGTGCCGCGCGCTGTTGGACCG
CGTGACGAAGCTTATCAACGAACAAAAGAACGAAGAGCGCGAGAGATGGGGCGGCATCTTTGGAAGCGGTCATGAGGAAGGAGCCAGGGCCGCTTATGCG
CAGAAGGGCACGCCAGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCAAG
GCGACCACGCCGGCTTCTGTAGCCACCGCTGCTGCTGATTCCGCGGCATCCGAGTCGTCCATCTTCACGCGCAAGACCAAGGCGCAGCGAGAGAAGGAGG
CTGCGAAGAAGGCCGCCATGGAGGAGCCATGGTATCTTTCACGACAAGCGCTGGCGACTGTCTCTCTGGTGACTGCCGGCGTTGCTGCGGTTACGCTGCT
GACTCTCAAGCAGCAACAGCGCTCGTAG