Transcript Name :
Pytiw_DAOMBR242034maker-piw_contig_93-fgenesh-gene-0.3
Orientation:
(+)
Number of Exons:
8
Description :
Aspartate aminotransferase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
DNA binding HTH domain, Psq-type14.48PS50960
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-617
*** None ***
*** None ***
TypeScore
nuclear739
GO
Biological ProcessGO IDPrediction Method
DNA bindingGO:0003677IEA
*** None ***
*** None ***
Sequence
        2410 bases(100 bases per row)
ATGACCAACACGGACGCGAAGATGCAGCTCGCGATCGCCGCCGTCTCGGGCGGCGGCATGTCGGTGCGCGAGGCCGCGCGCCGCTACGGCGTGCCGCGCA
CCACACTGCAGCGCAAGCTCTCCAAGGACGCGACCGGCGGTCACAGCGGCTCGCGCAGCAACAGCGTCACGAGTCCCGGAGCAAGCGGCGGCGGTGCCGG
CAGCGACCACAGTCCGAGCCCGACGAGTAGCAACACGGACCACATGACGAGCGCGCGAGTGGCGCCAGCAATGGCGTCGTCAGCGACGACATCAAACTCG
GTCGCAGCAGCGATCTCGAGCGCGATCGACGCAAACCAGAGCACCATGAACACGATCCTCGGGCTCTACGAGAGCAACGGCAACGGCACGACGCCCGTGG
CGTTCAGCAGCTCCATGAGTCGCAAACGGCCCGCCGAGGCCATGAACACACCCGACAAGCAGCAGCCGATCCGCAAAGGTACACACGCCACCAATGCTTT
GTCGTAAGCGCTAGGCTGTTTTTCTGACTCGTGTTCTTATTTAATTTGCGCATTTGAAGGACCACACAAAGCGATTAACTGCAAGGTCCGGATGCTCTGC
ACGTCGGCAGGAAGCGCGCTCGACGAGCTCAGTAATGAGATGATCATGGAGGGCAAGTGCATCTACAAGCTCGGCCTGGGCCAGTCGCCCTTCCCGATCC
CTCAGTGCGTCGTTGACGAGCTCAGGTATGATTTTTTGCTAATTTTTTTTACTGAGCTGCTTGAATTCCACGGTGTTCTATGGTGTCCAAAGAGCCAAAT
TGGAATATGATATCTGACTTTATTTTTATGTATTATTTTTTTAGAGCAAACTCGCACCAGCGCGAGTACCTCCCCGCCGCAGGGCTGCCGGAGCTATGTG
ATGACATTGCCGCATGGGGCACCAAGACGCTCCACATGAAATACACACGGGACGACGTGCTCGTGGGGCCAGGCACGAAGGAGCTGCTCTTCGTGTTACA
GACAGTGTACTACGGCGACCTGTTGCTGCCAAACCCGAGCTGCACGAGCTACGCTCCCCAGGCAAGCATCGCTGGCAGGTGAGAAAGGATTGCTTGTTTC
GTACGCAGAGGCCTCGTCTCGCCATATAGAAGGGCGGCAGTGGCTCATCTATGGTCATGTGCTGAATAGTGTGCCCGCGTTTGCAAATGTTAGGAACATG
ATTTGGCTCCAGACCAACGCCAAGGACCGGTGGGTCTTGCGGCCCGAGGTACTCGAGGACCACTGCGCCAAGGACCCGGACGCGCCTCGCATCATGATTC
TCAACAGCCCGTCGAACCCAACGGGCTGCGTGTACAGCGAAGAAGAGGTGCGTGCGGATATCTCTTGGGCAATGCTGAGCTGTCGTCCATTTAACGTGGA
TTTTTTTATTCATTCCTCTACAGTTGATTGCCGTGGCCCAGGTCGCGCGAAAGTACCGCGTGCTCGTGATCTCGGACGAGATCTACTCGGAGCTGTACCA
CTCGGGCGAGCACATGTCCATCTCCAAGTATTACCCCGAGGGCACGATCGTCTCGGGCGGCCTGAGCAAGTGGTGCGGCGCCGGCGGTTGGCGCATGGGC
TTCTGGATGTTCCCGGCGAGCATGAACTGGCTGCGCAAGAGCATGCTCGTCATGGCCTCGGAGACATACACGTCCGTCGCGTCGCCCATCCAGCACGCTG
CACGGCGAGCCTTCGTACCAGAGTAAGTATTATTGTTATTTCATCCATGCTTGAAGATATGTGTGCCCTCTTCGGTACGATCTCACCCAACATTTATTAT
TTATTGATTTTGTAGCTGCATTGAACTGGCAGCTTACAAGGACAAGTGTCGGAAGACACTGCAGATCATCGGCCAGTGGTGCGCGTACCAGATGCAAAAG
ATGAACCTCGACGTGCAGCTCCCGTGTGGGGGCTTCACGATGTTCCCGAGCTTTGCGCGCCACCGCCGCGCACTCGCGCTGCGAGGCATTACGACGGATG
TGCAGCTCTGCGCCCAGCTGCTGCACGACACGGGGGTCGCGATCCTCCCAGGCTCGTGCTTCGGCCGCTCGCCCGACGAACTCTACGTGCGCATCGCGTT
TGTGGACTTTAAGGGCGAGATCGCGCTGTACCTGATCGAGACCATGGTGAGTGTGTATCTTTCTGTGGTGGACATTTTTGGATGTCGTCTGTTGGGCATG
GGCACTGACAATTTTTATATGTGCGTCACCGAATAGGACGACCTGGCACTGGACGCGATTGACGGGTTCATCCAGTCCGTGTGCCCGAATCTCGACATTG
CCATGCGCAAACTGGCCAACTGGGTGAGCGCGAGCGACGCGCTGCTCGTGCCGTCATCACTGCTCGTCTCGCAGCTCGACGACAGCGCCATCCGCCCGCT
CCTAACTTAA