Transcript Name :
Pytiw_DAOMBR242034maker-piw_contig_1-fgenesh-gene-0.19
Orientation:
(-)
Number of Exons:
2
Description :
CAAX prenyl protease 1
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
38-117
178-183
233-332
388-457
1-14
141-154
207-209
356-364
15-37
118-140
155-177
184-206
210-232
333-355
365-387
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K06013
*** None ***
Sequence
        1626 bases(100 bases per row)
ATGAGCGCGTGGTGGAGCGCGCCGTTCTTCACGCAGGAAGGCTGGACGCCGACCTCCGTGCCGTACCTGCAGGCCGCCGTGCTCTTCATGACGCTCGTGT
ACGTCTTTGAGACGTATTTGGACGTCCGCCAGCACCAGAAGCTCCAGGAGAAGGCCTTCCCCGCGCCCTTGCGTGATGCCATCGGCGGCCTCGGCTCGTT
CACGCCCACGAAGGAAGACAAAGAGCAGGACAAGATCGACAGTGACAACAAGAAAGAGGACGAGCCCGCAAAAAAGACCTCGCTGCTGGACGTCACGTTG
GACAAGTTCGACAAGAGCCGCGCGTACGGACTTGACAAGAGCACGTTTGGCTTCGTCTCGGGCGCCTACTCGCAGGTCGAGGCCACCGTGCTGCTCTTCC
TAGGGTACCTGCCGTTCATGTGGACGCTCAGCGGCCGCACGCTCGGTGCACTGGGCGTGGACGCGACCAACGAGATCTCCCTGGCGCTCATGCTGCTGGC
GCTCACGTCGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNCGCGCTCTACTCGACGTTCGTGGTCGAAGCCCGTCACGGGTTCAACAAGCAAACGCTCGGACTCTTCTTCATGGACAAGCTCAAGAG
CTTCGTGCTGTTCATGGTCATCGGTTTCCCAGTCACGGCGGCGCTGATCTTTGTGATCCGGTGGGGTGGCGAGCACTTCTACCTGTACGTCTGGGCGTTC
CTGTTCGCGTTCTCGCTCATCATGACCACGCTCGTACCAGTGCTCATCATGCCGCTCTTCAACAAGTTTACGCCGCTCGAGGCAGGCGAGCTGCGCACGC
GCATCGAAGCGCTGGCGTCGAGTCTTCACTTCCCGCTCACGAAGCTCTTCGTGTGCGACGGCTCCAAGCGCTCGAGCCACAGCAACGCGTACTTCTTCGG
CTTCTTCAAGAGCAAGCGCATCGTGCTCTTCGACACGCTCCTGGAGCAGGCCACGCACGACGAGATCGTCGCGATCCTCGGCCACGAGCTCGGCCACTGG
AAGCTCTGGCACACGGCGCAGGGCTTTGTAATCCAGCAGATGTACATGCTCGTGCTCTTCTACGTCTTCGGGCTCTGCATGAACGACAGCGACCTCTTTG
CGAGCTTTGGCTTTGCGAGCAGCACCCAAGACGCCAAGCCCGTGATCATCGGCCTGCTGCTCTTCTCGCAGACCATGTGGGCGCCGGTCGAGCACGTGCT
GTCGTTCTTGATGACGCTCAACACGCGCAAGAACGAGTTCCAGGCCGACGCGTTCGCTGTCGATCTGGGCCACGAGCAGGGGCTGCGCTCGGGCCTGACC
AAGCTCGCGATCGAGAACCTCTCTAACATGAACCCGGACGCGCTCTACAGCGCTTACCACTACAGCCACCCGCCCCTCGTCGAGCGCCTCAACGCTATCA
CGGACCGCGTCAAGAAGCTCAAGTAG