Transcript Name :
Pytiw_DAOMBR242034maker-piw_contig_1-snap-gene-0.45
Orientation:
(-)
Number of Exons:
5
Description :
Transmembrane protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-286
339-443
310-318
287-309
319-338
*** None ***
PositionContextScore
103VAIRTKR|GK0.505
TypeScore
mitochondrial870
GO
*** None ***
*** None ***
*** None ***
Sequence
        1712 bases(100 bases per row)
ATGCTGCGCCTAGGAGTCACCGCAGTGGTCGCTGCGGGCAGCCGCCGCCCCGCGATGCAGCAGCTCGCGCTCGCCAACTTGAAGCGCTCGATCTCGCACA
CGGCCTCGCTCCAGTATGCGCGCTGTACGTCATGCAGCAGTCCCCTGTTGCATGTCCCCCTACGCGTACTTGCTGGCAAATGGCCACTAACGCCTTGTCT
GCTTTATGTCTCTCTGCATATGATTACACAGCGAACCGCGCGCTCGAACTCAAGTACAAGGACGGCACGTGCACGCTCGCAGTGCCGCTGCCACTCTCGG
GCTTCGACGAGGAGCGCGTCTTCAGCATCGCGCCCGAGTCGACGGTGGCGAATATCGTCGCGCAGATCACGGCCGAGGACAAGTCCGTGCAGACCGTGGC
CATCCGCACGAAGCGCGGCAAGGCGTTCAGTCCCGACGAGACGCTCGTCAACATCCTCAAGGACGACTTTGAGATCCTTGTCAACGACCGCGTGCTCCCG
GTCACGGCCCCCGTTTTCTCTGGTGCGTGCGTTTACGTCTTACGTTAATCTATTTACTAGGTATTAGTGGCGTGGCATGCAAAGCTGATCATATTTGTGT
GATGATGGTGTCGTTATGCTAGGCAACGCGTATGTGAGCGTGCTGGACGAAGGCGACCTCGATGTGCGCGCCATGGCGCAAAAGTCTGCGGTCATCTCGC
TGCGCCACAGCCTCGAGACGCTCGGCAAGTGGAAGATCAGCTACGCCGTGAGTACCTGTTTTAATTTGCCTTTGTTGCTTGCCATGGACAATGTACTCCT
TATCTAATTGCTCTTGTATGTTCATGTATATGGCAATAGGACTTTGTACTCATGTGCAAGGAGCGCGGCATCCCCAAGAAGCAGGCGCCCGAGATCCTCC
ACGCGTTCCACCAGTCGGGCATCGTGCTCTCGTTCAGAAAGGTGCGTTCTTTTTCCTCGATATGTTGTTTGTTATAGGTACAATTGCCTGCTTGACTAAC
AATGTTCTTCTTATATTCATAGTCGGAGGACGAAGACCTCCAGCAGTCGATCTTCCTGCAGCCGCGCAGTGTGATCGACTCGTACCTCGAGTCGATCGGC
CTCTCGCCCGTGTCGGCGCAGCTCTTTGAGCACGAGCGCGAGTCGCTCCTGGCGAAGATCCAGTCGCTCGAGCCCGAGCACGTGGCGCTCGTGAACCTGC
GCAAGGAGCTGCACAACGCGGCGACGCGCCACGCGAACTTCGTGTCCGTGGGGCTCTCGACGTCGCTTGTGGGCACCTTTGGGCTGTACTTCTGGCTCTC
GTTCATCCACTTTTCGTGGGACATTATGGAGCCCGTGACGTACTTCTCGGGCTTTGGCGCGAGCATCATCGGCTACGCGTGGTGGAGCATCACAAATCAG
GAGTACGAGTACGAGAACGTCTACGACTTTTTCTACAAGAAGAAGCTGCGGAAGCTCGTGACAAGCGCCCAGTTCGACCAGCAGCGTCTCGACCTGGTCA
CCAAGGCGCTCGCGGACAACACGACGCAGCTCGCGCAGGTCGAGCAGGTGCTCACCAAGTCGACGCATCTGCAGGCGAGCTACCTGCACCTGCTTGAGAG
TGAGCAGCGCGCCTGGGACAAGCACGTGATCAAGACGCAGACCGTGGCGGACACTGCCACTGCGACTGTGGCGGCGGTGCCTGGAGCCGATGCTGCTGTT
GCCAAGAAGTAA