/usr/amritdata/protein/develop/executables/log_for_browse/loglikelihood -s /tmp/images/bd_sequence_input_file_4a71b7cc3426e5d1342105a26c59072f -m /usr/amritdata/protein/develop/executables/log_for_browse/matrix/1223558 -w 120 -web -o /tmp/images/bd_log_output_file_4a71b7cc3426e5d1342105a26c59072f
Transcript Name :
Pytiw_DAOMBR242034maker-piw_contig_1-fgenesh-gene-0.12
Orientation:
(-)
Number of Exons:
2
Description :
Drug/Metabolite Transporter (DMT) Superfamily
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-109
170-180
228-255
316-327
403-420
133-146
201-209
279-292
351-379
110-132
147-169
181-200
210-227
256-278
293-315
328-350
380-402
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1345 bases(100 bases per row)
ATGGAGCACCGAGCCATCTCGCCACACGCTCTCCACGCTGCCACAGTGGCGGCTGTGTCCTTCGACGAGAGCGAACGCCACGAGGTCGTGATGGAGATCG
ACGCGAGCGACAGCAGCAGCTGGAAGCCCACGGCCACGAAGCTCAAGCGGCAGCTCGGCAACGACACATCAAGCGACCTGGACGCCATGGACTCGCCCTG
TGAGTGCAACAAGCTGCTCGCGGCCAGCAGTGACACGAACGCGTCGGTACTCAAGGCGAAAGAGCTCGAGATGATGCTCAACGACAGCGAGGCGGGCGTC
ACGAAGGCCACGGCCAACAAGACGAGCTACGTGGCGCCGCAGACCGTCATCTTCTGGCTCAGCATGTGGTTCGTTCAGAACATCGGCGTTACGTTCTGGA
ACAAGAAGGCGCTCAGCGTCATCCGCCTCCCCGTCACGGTATGTACTTATGATATGGGATGGGTCCTTAAGTATCCCCAACAAGTGTACTTATTTTCCCT
TCCGTGTCACTTTTGAACAGCTCACGTTCGTGCACATGATCTGCAACACGCTTGGTGCGTCGCTGTACATCTACGCGTACCGGGGCATCGAGCGCAAGCC
GCTCAAGCCCGGCCAGCAGTCGCTCATGGTCTACTTCTCGATCATCTTCGTGAGCAACATCATTACAGGCAACTGGAGCCTCGGGCTCGTGTCCATCACA
TTCAACCAGGTCATGCGCGCGCTCGTGCCGGGTGTCGTCGTGGTGCTCAGTATGGCGATCCTGGGCAAGTCGTACACGCGCGAGCGCAAGCTCTGCCTCG
TGCCCGTGGCCTGCGGCGTGTACATGGTGTGCACGGGCGACAAGACGTATACGTTCCTGGGCCTGCTCATCACGCTCGCGGCCGTGCTCTTCGCTGGGCT
CAAGGTCGTGCTCTCCAACAAGTTCCTCAGCGGCGACCTCAAGCTCCACCCGGTGGACCTGATCCTGCATCAGGCGCCGCTCTCGGCCTTCTGGTGCCTC
ATCGCCATGGTGCTCTCGGGCGAGTGGCAAATCCTGATGGCCAACTGGGACCGGCTCCCGGAGCTCTCGACGTGGTACCTGATCACGGGCGTCATCAGCT
TCCTGCTCAACGTCACAAGCTTCTACGCGAATAAAGTGACGTCGCCCGTTACGCTCTGCGTCTGCGGCAACATGAAGCAGATCTTCGTCATCACGCTCTC
GATCGCCATCAACCACGACGTGATCACCAACCAGAAGCTCTTCGGCATCTGCGTCGTCACGGTCGGCGGCGCCGCCTACGCCTACATCTCCAACCGAGAG
ATGAACCGCGCGGCCGTGCCCGTTCGTCCGCAGCACGCAGCCTAG