Transcript Name :
Pytiw_DAOMBR242034maker-piw_contig_1-fgenesh-gene-0.20
Orientation:
(-)
Number of Exons:
1
Description :
Bifunctional aspartokinase/homoserine dehydrogenase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
ACT domain6.975PS51671
ACT domain9.751PS51671
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-883
*** None ***
*** None ***
TypeScore
nuclear348
GO
Biological ProcessGO IDPrediction Method
amino acid bindingGO:0016597IEA
metabolic processGO:0008152IEA
KO ID
K12524
K12524
K12524
K12524
*** None ***
Sequence
        2652 bases(100 bases per row)
ATGGCCGACAGCAGCAAGTTCGTGGTACACAAGTTCGGCGGCACGTCCGTGGGCAGCGCCGAGTGCTTCGCCAAGGTCACGGACATCGTGGCGGCACTCA
CGGCGCCACGCGTCGCCGTGGTCGTGTCGGCGATCGGCGGCAAGCCCAAGGTCACGGACCTGCTCATCGGTCTGCTGAGTCTCGCCAAGCAGCGCAAGTC
GCAGGAGTGCGACGCCGTCCTTGACGTGATCCGCGAGAAGCACCACAAGGTGATCTCCGAGATGCTGCCCGCCGAAGTGGGCCAGCCCATCGAGGCCGCG
ATCGACGCCGACCTCAAGCGGCTCTCGGAGCTGCTGCGCGCGATTTCGATCATGCGCTCGTACAACGACAGCGTCGTGGAGTTCATATCGGGCCACGGCG
AGGTCTGGTCGGCCAAGATCCTCGCCGCCGTGCTCACGCTGCGCGCGGCCGCGGACGGCAAGGCGCACAAGTTCCACTTTGTGGACGCGCGCGAGTTTTT
AATCGTCGAGCCTGACGAGGACCATGGCCCCGTGGTGCAATACGACATCACGACGAAGAACATGGACGCTATCTTGAAGGCGGGCCAGGGCGACGGCCAG
GCGCTCACGCACCTTGTCATCACGGGTTTCATCTGCAGCACGACCGAGGGCGTCATGACGACGCTCAAGCGCGACGGCAGCGACTTCACGGCCTCGATCT
GCGGCCGCGTGCTCAAGGCGAGCAGCATCACGATCTGGACCGACGTCAGCGGCGTGCTGAGCTCGGACCCGCGTCGCGTGCCCGAGGCCAAGATCCTCGC
CGAGGTCTCGTACGAAGAAGCCATGGAGCTCGCGTACTTTGGCGCCAAGGTGATTCACCCCAAGACCATGACGCCCGCGATCCTCGAGGCGATCCCGATC
TACATCCGCAACACGTTTGAGCCGGACCACCCGGGCACGAAAATCTACCACCGCAAGCGCGTCGAGCTCGAGCGCAAGCTCTCAAACGGGCTGCCGAACG
CCAAGAACATTGTGAGCGGCTTCTCGACAGTGGACGACCTGGCGCTATTCAACATTGAAGGCAGCGGCATGGTGGGCGTGCACGGCACGTCGTCGCGGCT
CTTCAGCGCTCTCGACCGCGTCAAGGTCAACGTCGTGCTCATCGCTCAGGCCAGCTCCGAGCACTCGATCTGCTTCGCCGTACCCATGAGCCGCGCCATG
GACGTACAGGAGGTCGTGAACGAGACGTTCTTTAAGGAGATCCACCACGGCCTAATCGAGAAGACCGAGTTCATCGCGCCCATCAGCATCATCGCCGCCG
TGGGCGACAACATGAGCCAGACGCCAGGAGTGTGCAGTCGCTTCTTCGGCGCGCTGGGCCGCGCGGGCATCAACGTGCTCGCGATTTCGCAGGGATCCTC
GGAGCGCAACATCTCGGCGGTCGTGCGCTACGAGGACTCGGCCGCGGCGCTGCGGGCGGCCCACTCGGCGTTCTTCCTATCAGACCAGACGATCTCGATG
GCCATTGTCGGCCTCGAGCACACGGAGGATGACCGCACGGGCGTGGGCAAGGCGCTGCTCGCCCAGTACAACCAACAGCGCGAGTACTTGAAGCAGCGCT
TCAATGTGGACATCCGCATCCGCGCGATCGCGACCCACTCGTCGTCCAAGATGCTGCTGGACCACAACGGCGGCCTCACGTCGGACGCACTGGAAGCACA
GGCCGATCTCTTTGAGCCGTTCGACCACGAGCGGTTCCTGAACCACGTGTGCGCCGACCACCTACCGCATTGGCTCATCGTCGACGTGTCCAACTGCCCG
GGCCATGTGAAGAATCTGTACCCGACGTGGCTCAACCGCAACGTGCACCTCGTCACGGCCAACATCAATGTGGCCGCGGCGTCCACGAGCCTGCACAGCC
TCATCCGCACCAAGCTGCGCGAGAAGGAGCTGTTCTTCGACGCTGAGGCCTGTCTGGCTATCGGCGTCCCAATCTTCAACACGATCCAGAACTTTGTACA
GACGGGAGACGACATCCGCCAGGTCGAGTTCTCCGGCAGCTTGTTCCTCAACTCCGTGCTCAGTGCCGCCACATCCACTGGCAACGGCGACGTGGACCTC
CCAGCGCTGCTCAGACAGCAGGTGGACGCGTTCAAGATGAAGCTCTCGGTGCGCGACCTCCTCGACGACGTCACGGGCGTGCGCAGCGCCAAGAAGGCCG
TGCTACTGGCGCGTGAGCTGGGCTTCCGCACTGAGCTCCGGGAGGTCGCGATCGACTCGTGCTGGCGCTCGCTGGACGACAGCAACGACGACGTGGCGCA
GTGGGACTACGAGCGTCTACTCGCGCACTTGGTGAGCAAGTGCGAGCCCCTGCAGCAGCAGATCGCAGCGGTGGTCGCGAACCGCGCCGAGACGCCGTCA
CTGCGGCTCATGGCGTTTGTCGACGCGCAGAGCGGCGCGATCTCGGTGCGCGTCCAAGCGGTGCCGGCACAGCACGTGTTTTCATCGTTGCAGCCACTCC
AGTGCGCGTTCGCGTTCTACACGGCGCGCCACGCGGCGCACCCGGTCGTGGTCTCGGGCCCAATCGCCGACAGCGCCATCACGGCCGGCACGCTCTTCGG
CAGCATCCTGAATCTGGCCCGCAATTGCGGCGCGCGCGAGTCGGGCAAGTGA