Transcript Name :
Pytiw_DAOMBR242034maker-piw_contig_1-fgenesh-gene-0.18
Orientation:
(-)
Number of Exons:
6
Description :
Guanylate-binding protein, N-terminal domain containing protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1136-1217
1-1112
1113-1135
*** None ***
PositionContextScore
743ETERVKR|EI0.65
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        4184 bases(100 bases per row)
ATGTCGCCGTCGCTCGAGCGCGAGTGGCGCGCGCTGCCGCTCGTGTCCCGGATCGAGTCGTCCGCTACTAGTGGCGGCAGCACGCAGTTGCGCATCGAGC
CGGAGGCGCTGGCGGTTCTGCGTGAGGTGCGCGCGCGCAACATCCACGTGCTGGGGCTCTTTGGCCCAGGGAACACGGGTAAGCGGCTCTTTCTCAAGAC
GCTGCTGAGCTCCAAGTGCGACTTCGCCGCCGCTAACGCATCACCAGAGAGTCACGTGCTTCTCTGGCTCTGGACGCCAGTGGGTGCGCTGCGTGATCCT
GCTGCTGGTGATGATGGCGAAAGCGTCAAACTCGTGATCTCAAGCGGCGCACAGGCGGGCGACACTGCGACGGATCGCAAGCAGCGCCTTGCGCTGCTGC
TGCTGCTCTCCTCTGCGCTCGTGTACAATGACGATGGAGAGCTCAACGCGCAGGCGATCGAGCGCCTTGACTGGCTCGCAGACATCGCGCAGATCCTGCG
CATCAAGACTAACCAGGACGAAGCAGGCGTTGGTGTGTTTAGCTTGCTTCAACCAGCCATTCCTATGAAAGAGGTTCGTTCACTAACGCTTTGTGTGGTT
GTTATATTAGCAAATGACTTTAAACAGCACGCACCAAAGTTCATCTGGCTCGTGCAGAACTTCAAAGTCAAGTGGCTCACCGGCGACGACGGCGAGAAGC
TCACCCCGCTCCAGGTACAGCATATCAATGGCTATCCTGTCACTCACCTTTATGAGCGTGAGTCCTAACCGCGAACTAATTATGCTCTATCATGTTGCAG
TACTTTGAACGAAGCCTCCAAGACGAGAACGGCTTCAGCGACGCGGTGGCAGGTCGCAATGCAAATCGCATGTACTTCAACTCGTACTTTTCCACGCGCG
ACTGCGTCCCACTGAGTCGCCCTATGGAAGGTGCCGCGACAGACGTGGCACCAAACACCGAGCGCGATGCACTGCGCAGTCAGTTTGTCGAATCGATCGA
CAAGTTCTACGCGTCGTACCTCTCGACAAAGTCTAAGACGTCGCTGCCGGCCAAGCAGCTGATGGGCAAAGAGCTGCGAGCCGAGCAGTTCGTCGTCGTG
CTGGAGAGCTTCGTGGACGCTATGAACAGCAAGGCGCTGCCGACGATCACGCAAGCGTCGACCACGTTGCTGCAGCGCTCCATCACCGAGGGCTTTCAAG
CAGCCAACCAGGTCTACCAAGAGGCAACCGCGGCAGTCGCTCTCTCGCTTCAAGAGGACAAAGCGCTCTCGCCGCATGAGCTGCAACTGGCGCACTACTG
TGGCGTCCAGAAGGCGCTGGCGAAGATCCAGGAGCTCGCCGCAATCCTCCCCGAGCAGCTTCAGAAGACGGTGTTCAAGGAAAGCTTTTCCGAGTGGGAA
GCTCAGGTCAAGAGCAATTTGGAACAGCTGACGCAGCAGAACTCGAAAGTGTCGCGTGACGCCTGCGAGGCGCTCATCAAGAGCCTCTTGCCGCACAATC
TGGAGGAGATGGCGAGCGATCTCGCGTCAAAGTACGTATCTTGGCTCTGCTTGACTGCAAAAATAGTTGATGGACGCTGATTTGTGTGTGTTCGTGGCTT
CTTGTCGTGCATTAACAGACATCGCGGCTCATTCTCGGACGGTTTAACATCGCTGCTCTCGCAGTACAAGTCGAACTTGCGTCAGGCCATCGACGAATAC
AAGGCGCAAAGCAGCGGTCCGTCGATCCACGAGTCGCTCGAGCAGGCGCTTCTGCAGTCCGTGTTTGCGTCCATCAAGAACTGGGGCATGATCGTGCTTC
GCCAGTACCAGCAGCACGTCCGCGCCCTAGTCGACGAGCGAGACGCGCTGGAGAAAGACTGTGAGGCCGTGAGATTGAAAGATACGGACTCAGCGACTTC
TGCTGACGACCAGAAGCGCATGTACGAAGAGAAGCTTGAGCAAGCGACCAAACAGCTCTCGGACCTGCGGAAACTTCTCACGGGTGAGCTCAACGATAAG
AAATCCGAACTCGAGCGCCTGACGAACGACATGCAGATGATGGAAATGAAGCAGGATGTGCGCGTGAAGAACGTAGAGAATGACATTGCCTGGACACGCA
GCCGCACGGCCGAGCTCGAGAAAGCGTCGATGCAGGAGAGTCAGCGCCCGGAGAGCGAACTCAGCGGCGCAACACAGAATCTGCTGACCAAGGAGCGCAG
TTTCTACGAAGAGGAGCGCTCGTTGCTCACGCAGCAGCGCGAGATGATGGACCGCATGGCGCAGCTCGAGCGCGAGGTCGCACAGAAGAAGACCAAGCAC
GTGCAGCAGGTGTTCCAGCTCGAGAACGCGATTGCCAGGAAGGCCGACGAGATGAAGACCGAGCACGCTGAATTCGCGCGGCAGCTCAAGACCCAAGCCA
AGACGGACACGGGCGTGCTCAAGCTCGCGTACCAGAAGAAGAAGCTGGTCGTGCAGAGCGAGACTGAGCGTGTGAAGCGCGAGATCGACGAGATGCGCGA
GAAACTGGTGCTCTTAAAGAGTCCCGTGAAGCGCACGTCGTCGATGAGCAAGATCAACCGTGACTTCTTCAGCGCCATGTCGCTGCCGATGCCGGCGATT
CCGATTTTCCCACAGTCGCCGGACAGCAGCCAGGTGGCTTCAGCTGGCAAACGCCTGAATCGCTCGGCGTCGATGGACATGTCGACGAGCACTGCGACGA
TCGGCCCCAACACTGCGACTCGCGCAGCTGCGTCGCGCACCAACAGCGACCTGTGCAAGCAATCATGAACAGTAAGCTGCAGCTTGAACCATCGCAGGTC
AACCTGCGAGTTGAATCTTTTTATAATAGTCAGATGATAGCCTCCCAACATATTCGCAAAACCAATTTCCTCACTCACCTCAGATTGAGCATCTCCAGTG
ACAATGCGCTCGAATCGCTGCGTCGCGTGCCTGCTCGTGACGACGACCGGCAGGATCCTCGTGCAGTGGGAGCTGGACGCCACGCTCCCGCTCCGGTACC
CGCAGCTCGCGCTGCTCATCGCGAGTCTGGTCCAGTTCTCCAACACGCAGCCGTCCGCGCAACTGGAGCTCAACAATGGCTTCACGCTCATAGTGTGCTC
GGACGCAATCTCGCAGCTCTCGTGCGTCGTGGTGTGCAAGACGCCGCGAGCGAGCGAGAGCAAGATCCCACAATATTTCCGCGCACTCGACATGGCGCAT
CTCAGAAGCCTCGTAATTCTCAACGAGTTCCTGCGCTGCTATCGTGATCAGGTAGACGAAATCGTCGTGGAGAGCAAAGAGGCCAGCGAGCAGATGGCCG
AGAGGTATACGCTCACGAACGCTCTGGGAGGCGGTGGGCGGGGTGACGCAGGCTCCGACGGCACCCTCGATCTCTTCGCTGTGTTCCAGAACGAATTCAT
CGCGCCCATGATGGAGGACAACAGCGCCGAGAACATCCGTACGGGGATCTCCGACTCGGTCGCCAAGACGAGTGTGTCGGCGACTGAAATCACGCGACAG
TTCCTCATCAACGCCGACTCGGGCAGCGTGCTCTACGCGCTGATGGGGGCGCCAAGGCTCTTGGTGCAGCATCGCTATCTCGAAGAGCGATTGCAAACGC
AGCAGCTGCTCAAGCGCGTGACGCAGGCGTTGAGCAAGTGCTTCCCCATCTTGCAGCGGACATCGTTGCTCACGCGCAACCAGGAAGACAGTCACGTGGG
CTTCTCAAACACCAGTGACGTGAGCTCGACGACGATTGTTCTCCGCCTCGGAGGCGACACCCCGAAAGACCTGGCTTCGTCGGCTGGAGTTCTCCATATC
GCTGTGCAGATGCTTGGCGTACGTTGCCTGGTACTTTCACCCTCAGCTCCATGAAGCAAACGACTCACGAGCTCTGTTTTGCTTGATGACACACAGGTGG
GCACATTCGCGTCAGTGGTCTTCTTCTATGGCTTGAACGACCGGTTCATGGGCCACTCAAGCCAGCTGGTCCGCTCAGGCGATCTCCAGCGCGTGCTCAT
TGCCGATCCTCGCGGCAGTCAGTTCCTCGGACTCGTACAGGAAGGCGCGCTCGCGTCCGACTTTCAGCTCCACGTTGGCTCGGACGGCGCGCCTGAGAGC
GTGCTGCAGGCACTGGAAAACGTAGCGGCACCATGGACCAAGATCTATTCACCTGCGTCGAGAACTTCATCCTTGGTTCGCTGA