Transcript Name :
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_1-abinit-gene-0.99
Orientation:
(+)
Number of Exons:
3
Description :
Cathepsin B, cysteine protease family C01A
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Peptidase C1A, papain C-terminal5.3SM00645
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.7050.8122
InsideOutsideTMhelix
421-433
1-397
398-420
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
cysteine-type peptidase activityGO:0008234IEA
proteolysisGO:0006508IEA
*** None ***
*** None ***
Sequence
        1474 bases(100 bases per row)
ATGCCAGGAATTCGCACTGCTGCAGCGTCGCTGGTGCTGCTGCTGAGCGTCGCGACGGACGCCAAGCGCGTGTGCACGCGCACGTTCAAGGAGCGCGAGC
ACCTGCACCCGACGGTGCACACGCTGCCGGCGCTCACGGGCGCGCAGACGCTCGAGCTCTCGACGTTCCCCAAGAAGCTCGACTGGTGCGACCAGGGCTT
CTGCACGGCGTCGTGGAACCAGCACATCCCACAGTACTGTGGCTCGTGCTTTGCGCACGGCGCGCTCTCGGCCGCGCAGGACCGCATCAAGATCCTGCAC
AAGCAGCGCGGGTACGTCGGCCCGGACGTGATGCTCGGGCGCCAGTCGTTCCTCAACTGCGCGCCGGCGCACGGGCTCTCGGACGGCTGCGGCGGCGGCG
AGCCCACGGATGTGTTCGAGTTCATGAGCAAGTTCGGCCTCCCGGACGAGACCTGCCTGCCGTACAACGCCACGGACCACCGCAAGTTCACGCAGACCAA
CGGCACGTGTCCCCCGGAGGGCTACTGCATGAAGTACGTACCCTGCGTGTCTTATATTATTAGCCCGTGCTTTCCTTATACTCAACGCGCTGTGTGTTTT
TCCATTAGCTGCATGCACACGCCAGAGAGCCCGGATGTGCCCATGTGTTTCCCCGTCAAGACCGTCGTGCGCTACCGCGCCAAGGAATACGGACGCGTCA
CGGGCGAGCACGCCATGATGAAGGAGCTGCTGCGCGGCCCCATCACGTGTGGCATCGCGTGCAGCGACGGCTTCACGTTCGACTACCGCGCGGGCGTCTA
CGAGGACAAGACCAACTTTATGGATATCGACCACGACGTCGAGATCGTCGGCTGGGGCGAGGAGGACGGCGTCAAGTACTGGCACGTGCGCAACTCATGG
GGAGCGTACGTTGTTGTTTTTATGGTTGGATGTTACAACGTGCACACTTAATGGCTTCTGGAGGTTGCAAGAAATTTGACTTCTGATAATTTCTTAATGT
AGGTATTGGGGCATGAACGGCTTCTTCAAGATCGTGCGCGGTGTGAACAACCTGGGGATCGAGGCTGACTGCCACTACGTGCTGCCAGACATTTCGGACG
AGGAGCTCACGTTCTCAGAGACGCCAATCTACGGTGGCTCACACTGGGGCATCGTCCCGTTCGCCAAGGACGCGGCCGTCAACTTCCCCATCCAGAGCAC
GGACGACGTGGCGTTCAATAGCATTCCATTGAAGTCCGAGGAGCTCCCAGAGGGTGCCACGGACTCGCTGGACTCGAGTGACGACGTCACTGTCAACGAT
GTGGCCACGAGCCTTCGCGCCCCTCTTCGAGTTGCGGCCGCGGGAATTAAGAGCCACACGGCGGGGCTCTCCGTCGCGGCGCTGGTCGTGGCGTTCACCT
CGTTTGGCGCTGCGATCGGCTACGCAGTCGCTCGCTTCTCGCGCGGCACGACGACCTACGCGCGCATCAACTAG