Transcript Name :
Pytiw_DAOMBR242034snap-piw_contig_1-abinit-gene-0.132
Orientation:
(-)
Number of Exons:
2
Description :
Dynein heavy chain
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
AAA+ ATPase domain0.76SM00382
AAA+ ATPase domain6SM00382
AAA+ ATPase domain0.075SM00382
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
nucleotide bindingGO:0000166IEA
*** None ***
*** None ***
Sequence
        12721 bases(100 bases per row)
ATGGATGGGTCCTCGCATGCGCGGAGGCCAAAGCAGCAGGCGGCACCTCATACTGCCGTGAAGAAGACAGACTACGCAGCAGCTGCAGGTACGAGCCCGC
ACTCGATCTACGAGCTCGCGGTCGACCACACGTTCGAGTTCGATGGTGGCACAGGTTTTGGCTCGACGCTGCAGTCCAACCGGCCGCTCCCAGCGAGTCC
CGCTGCTCATGCCTCGCTGTTGGTCGCGCCGTCACCTTCCGCGTCTTCATCAGCTGCATCAGGCTCCCACAAGTTCACGTTCACGAGCGCGGGCGAGTAC
ACGTCGCCCAAGAAGATCCCCGTCTTTCCCGGCACGTTCAGCAGCCCCGAGAAGAAGAAAGACGCCAAGCGCGGCACCAGCAGCTCCATTCGCTCTAGGA
GTCCGCGTGGCAAGCCGTCTGCAGCAGCGGCTGGATCGCCGTTGGGCTCAGCCTACAGCATTCGAGAGCGAGGCGCCTCCGACAGCTTTGAGAAAGCGGC
GACGGCCGTAGGCAACAAGCCCAAGCGGGAGGCGTCTCCACGGAAGTTCTTGCGCGAGTCGCTCGCACAGCGGCCCTCAGGCTTCCACGGTGATGATGGC
GACGATGGCGATGAGTCGGAACACCACCACCAGCACGACAGGCGCTCGCTGTCTCACTCGACCCACGCTCTGCGCCCCGCGTCACACGTCGCTACCGATT
CGCTCCAACAAAGTAGTCCGAACCAGGATGCTACTGGCGCCGTCCTCTTCATGGAAAACCACGACCCAGCAACGCAAACCTCCAACATCGCGACCGCAGA
CGCCGCCGCGCTGGCCGCCGCTTCTTCGGCTACGACGTTCCTCCAGACTGGCGAGGACGCCATCGCCTTCTTCGCGCGCAACGGCTCGGACAGCGAGATC
AAGTTCGTGCACCTTAACCGCGCGCACACGGGGCTGGCGTTCCGGCCCTACGACCTCGTGGTCGTCGCCCAGGGAGACGTGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGCGAGCACTTCACTATGTCCTCGAGCGGCCTCGTACACATGAGCCCTGG
GAACCCGTCCGAGTTTGTCGCGCTTGCCGAGTGGATGCGCCAGTCCACGCTCTTCAACGTACTCACGTCCTTCCGGTTCTTCAAGTACTACCTCGTGAAC
AAGTCGTTCTCACTCTGGTGCGCCAACGTGCGCTTCAAGCTCTACTGCCGCCAGCGCAAGAAGCTCAAGAACAAGCTTTTCCTCGCCAAGGAGAGCTTCT
GCGCGCCGCTGCTGCACGTGAAGAAGGTCATGAGCACCGAGGTGCTGAGCGTTGTGCTGCTCGACCTGCGCGCGCAAAAGACCTACGAGAGCGCCGCCTT
CGTCGAGTACCAGGCCACCAAGCGAGCTGAGGCCTCCAAGCAGTTCGAGACGTGCATTGAGAAACTCCAGGCGATCGTCCAGAAGGTCTGCATCGACGTC
AAGAACCTCACGAAAATTTCCGACCCGCAGGAGGATTTTCTCTCCGACAATGTCCAGTTCAATGGCACCTCGAGTAGCGGCAGCGCGCAAGAGAAGACCA
AGTCCATCGTGGCCGTCAAGTCCGAGCAGCAGCAGCGCCGCAAGCTCTTCAAGCGCGCCGCCGAGGAGGCCGCGGTGATCTCGGACCTCATCCGGCTCAT
CGACTACGTGGCTGTCGAGAGCTTCGTGGTGCTCGCAACCCAGAGCTGTCGCGAGTTCCTCCAGGAGCTCAACAAGGTCCCTCGCAAGACGGGACTCTTC
GAGACCACGATCTTCTTCGGCGAGGACTGCACGATCTTCGCGCCCACGAGCGAGCAGATCCAGCACATCGTCGTGTCCATGACCGATGACATCGTGAGCA
CCGTCAACTCGGTCTCACGTGTGCTCTACCTGCGACCATTTGCGCCGTACGTAGTCAACGTGGTCGCCGACGCGCCGCACGTGGGCGCTACGATCAGCTC
GAGCGTCGACTTCCAGCAGATCCGCAAAGACCTCGTGGCCAAGATCATCACAGATTATGCCGAGGCAACCGAGTACGTCAAGATCTTCGACAACGTGCGT
CCGATCTACGAGTACGACAAGATGTGGGACTTTGACGAGTACGCGCAGCGGTCGCACACAGTCGCGACCCTCAAGACCGACATGCTGCAGATCAGCACGT
GGGAGAAGGAGCTCGAGAAGATGCGCGCTGGGCAAACCATTGGCATTCTGCACGTCGAGAGCCGCAAGCTCAAGCAGACGCTCATCCCTATGACGACCGC
CAAGCTTGACGCCATGAAAGGCCTCGTGAAGGACCTCGCGCGCGCCAAGTGCAAGAACCAGCTCATCGAGTACAAGCAGCGCATCCAGGCGCTGCTCCAG
CGACCACAGCACCTCAAGGAGTTCGCGAGTCATGTCGAGCGCATCCAGGCGCTCAAGCAGAAGCAGAAGGCGCTCTCCAAGAACACCAATGTCGTCGACG
AGCTCTACCGGCTGCTGGGCAACTACGGTGTGCGTATCTCGTCGGAAGACATGGTGCAGCTCGACGACCTGCGCAGCGTCCAGGAGAACTACAAGGATGA
GACCGATGCCGTGGATGGCTTCGTGCAGGGCCGCCTCAATGACATGACGCAGCAGCTCGAAGCGAACATCCAGCGCCTGGACGAGCAGGTGCTGCAACTC
AACGGCCAGCTACAAACGGGGCTCTTCATCGACCCGGACCAATTCGAGGACCCGACGCTCGTCAAGAACGAGCTGGATGCAACCAAGCAGCGACTCACGC
AGCTTGACGAGCTCTCCAAGCAGTACACCGAGTACCAGATGCTGTTCAACCAGCCGACGTTCAAGTACATCAACCTGCAGGCGACCCAGGAGTTTTTCGC
AACCGTCGAGTCGCTCTGGACGTCGGTCGAGAAGTGGAACGAGACATACCACGCCGCACTCACCAATTCCTTCGTCGAGGTGAACGTCGAAGAGCTCTCC
AAGGAGATCGCCGTGGCGTTCAAAGACGCCTATGCGCTTCACAAGAAGCTCAGCAACGATGTCACGGCAGTGTTCAAGGACCGCACGGCCGAGTTCAAGC
TCAAGATGCCAACGATTCTCGAGCTGGGCAACCCGGCGATAAAGGACCGACACTGGGAGAAGATCTTCAAGGCACTGCGTCAGCCGTGGTACCCGGGCAT
CATGTTCACGCTCGAAAACCTCATCGCCTACGACGTGCTGGATATGAAAGACCTCATCGGTGAGGTCTCGTCCACGGCGTCGGGCGAGGCGCAGATCGAG
GCGTCACTCGTCAAGATCAAGCAGGGCTGGGACCAGATGGCATTCACGTGTATGAGCCACCGCGAGCAGAAGGATGTGTTCATCCTGGGCAGCCTCGAGG
ACATCTTGACGCTGCTGGAGGACAATCAAGTGACGCTGCAGACGATGATGGGCTCGCGGTTCATCATGGGCGTCAAGGACGAGGTCGAGCGCTGGAACAA
GCGCCTCTCACTGCTCTCAGACACGCTCGACGAGTGGATCACGTGCCAACGCAGCTGGATGTACCTCGAGACGATCTTCTGCGCCGAGGACATCCAGAAG
CAGCTGCCCGTGGAGGCGCAGAAGTTCGCGCTCGTCGATAAGAACTGGAAGAACGTGATGATGCGCACCAACATCGACCCGAGCGTCATCCGGTCCGTCG
AGAGCGGCTCCGACCTGCTCGACCAGTTTCGCATGTCCAACCAGATCCTTGAGGAGATCCAGAAGTCGCTCGAGGACTACCTCGAGACCAAGCGCATGGG
CTTCCCGCGTTTCTATTTCCTCTCGAACGACGAGTTGCTCGAGATCCTCTCGCAGACGAGAGATCCGCGCGCCGTACAACCGCACCTCGGTAAGTGCTTT
GACGCCATGAAGAGCATCCGATTCGACGAGACTGCTAGCATCAAGCCCGGCGTCGCGAGCAATGTCGTGAACGCCATGATCAGCGGTGAGGGCGAGATCG
TCGAGTTCCCGTCGCTCGTTACTGCTGCTGGACCAGTCGAGACATGGCTCGTAGAAGTCGAGAAGGCCATGCGCGCGAGCCTGTACGAGGATGGCGTCAA
GTCGCTCACGAACTACCCCATTGAGGACGCGATCGACCGGAAGGAGTGGCTCTTCGGGTACTCGGCGCAGGTGATCATCCTCGTGGACCAGGTCTACTGG
ACGCGCAATGTTACAGAGGCGATCTCCCAGGTCGAGAACGGCAACGACCCGAACGCCATCGGTGGCTTCCTGCAGTTCAGTCTCAAGCAGATCGACGGCA
TGGTGCAGCTCGTGCGCGGCTCGCTCTCCAAACTGCAGCGCATCCTTATGGGCGCCGTGATCACCATCGACGTGCACGCACGCGACGTCGTGCGGTCGCT
GGAGGAGAGCAAAATCTCGTCGTTGAGCGACTTTGAGTGGACGCGGCAGCTGCGCTACTACTGGGAGGACGACGTCAAGAACTTTGTCGCGCGACAGACC
AACACGCGCTTCATCTACGGCTACGAGTACCTGGGCAACTCGCCGCGCCTGGTCATCACGCCGCTCACAGACATATGCTACATGACACTCACGGGCGCCC
TGCACCTGCGTCTCGGTGGCGCGCCCGCTGGTCCTGCAGGTACGGGCAAGACCGAGACGACAAAAGACCTTGCCAAGGCGCTCGCCGTGCAGTGCGTCGT
CTTCAACTGCTCCGACGGCCTCGACTACAAGATCATGGGGCGGTTCTTCTCGGGACTTGCACAGGCAGGCGCCTGGGCGTGCTTTGACGAATTCAACCGC
ATCGACATCGAAGTGCTCTCAGTCATCGCGCAGCAGGTACTGTGCATCCAGCAGGCGATCATCGCGGATGTTGATCAGTTCGAGTTCGAAGGCAAGATGA
TCCGGCTCAACACGGGCTTTGGCGTCTTCATCACGATGAACCCCGGGTATGCTGGGCGCACCGAGCTCCCAGACAACCTCAAGGCTCTGTTCCGACCTGT
AGCGATGATGGTGCCGGACTACCGGCTCATCGCAGAGATCGTGCTTTTCTCGGAAGGATTTGCGAATGCGCTCCCGCTTTCGCACAAGATGACGCAGCTC
TACTCGCTCTCGAGCGAGCAGCTCTCGAAGCAGGATCACTACGACTTCGGCATGCGCGCAGTCAAGTCTGTGCTCGTCGCGGCGGGGCAGCTCAAGCGCA
AGGAGCCCGAGATGCACGAGGACTTGCTGCTAATTCGCGCGATGCGCGATAGCAATGTGCCAAAGTTCCTCGAGCAGGATCTGCCGCTCTTCCGAGGCAT
CATCGCAGATCTCTTCCCGGGCGTCGTTGTACCATTTGTTGACTATGGTCTGCTGCAAAAGGCGATCGAGAAGCAGCTCGACGCGCTCAACTTGCAGCAG
GTGCCGTCGTTCATCGCCAAGGCGATCCAAGTACACGAGACGCAGCTCGTGCGCCACGGGATGATGCTGGTTGGCGAGGCTGGCTCGGGCAAGAGCACCA
ACTGCTACGTGCTCTCGCGTGCGCTGACACAGCTCTTTGAAGACGGCGTCGTGGACCGCGACGGGTACTACAAGGAGGTACATCGCCTGATCCTAAACCC
AAAGTCGATCTCCGCGGGCCAGCTCTACGGCGAGTTCAATCTGCTCACAAACGAGTGGACCGATGGACTCGTGCCCAAGCTCGTGCGCCAGTGTGTGCAA
GAAGCCGCGGAGTCTGACAACCGCAACTGGGTGATCTTTGACGGTCCCGTCGATGCGGTGTGGATCGAGAACATGAACACCGTACTGGATGACAACAAGA
CGCTCTGTATGTCCAACAGCGAGCGCATCAAGTTGCCGCACACACTGCACATGATGTTCGAAGTACAAGACCTCCGAGTGGCGTCGCCGGCGACCGTGAG
CCGCTGCGGCATGGTGTACATGGAGCAAGTGCACGTGGGGATGACGTCGCTGGCGCGCACGTGGAAAGTCACAACGCTCGAGAAGATCCTCGCGGCGCCT
GAGCTCTGTACGATGCTGCTCGCGCTCATCGAGACCCACGTACCGATTGCGATCGACTTCGTGCGTGATCACTGCCGTGAGAAGATCGCAAGCAACAACG
CGAACTTGATGACCGGTTGCCTCAACCTGCTCGCGTCCTGCTTGACCAATGACGCAGCGCAGGCCGGGAACAACGTCACGGACCTCGGAGTGATGCTGCG
CATGTACTTTGTCTTCGCCGTGACGTGGTCGGTGGGCGCGAACATCGACGACGCGTCTCGCCCAAAGTTCAATGACTTCTGCATGGGCCAGTTCCGCGCG
CTCATCGACGGCGAGAACGGGAGCAACAGCGTCAAGATGGTCGACAACGTGTACGACGTCGTGGTCGACGAAGCCACGGGTCAGTGGGTCTCGTGGGTCG
AGAAGACCCCGCGGTTCACGTTCCAGCCGGGGTCGTCCTACTTCAGCATGGTCGTGCCCACGCAGGACACAACGCGCTTCCGCTACGTGCTCGAGAAGCT
GCTGCTGACAGACCACCACGTGCTCTACAGTGGCGAGACGGGCGTGGGCAAGTCGGTGATCATCCAGACATTCCTGGACGATATGGCCAAGACCGACGGC
TGCATCTCAGCGACCATGAGCTACTCAGCGCAGACAAAGCCGCGCAATCTGTACGAGCAGTTTGAGCTCAAGCTTGAAAAGAAGCGCAAGAACTTGCTGG
GCCCACCCACGGGAAAGCGCATGCTTTTCTTCGTCGACGATCTCAACATGCCGGCGCTTGAGATCTACGGTGCCCAGCCGCCGAACGAGCTGCTGCGCCA
GATCATCGACCAGGGCGGGTTCTACGACACATCCAAGATGTTCTTCAAGAACATCAAGGACGTCGTGTTCACAACCGCCTGTGCTCCGCCGGGCGGTGGA
CGCAGCGACGTCTCTCCGCGGCTGCTACGTCACTTCCACATGGTCTGGATCCCAAATCTGTCGGGCGAAGCCATGAAGCGCATCTTCTCGTCCATCTTGG
GCGGGTTCCTCGCCGCTGAACTCCCGCTCGTTGTTCAGATGGCGAATCCGATCGTGAACGCGTCCGTGCAGTTGTACCAGCGCGTGGAGCTCGAAATGCT
GCCGACGCCGTCCAAGTCGCACTACACGTTCAACCTGCGAGACCTTTCCAAAGTCTTCCAGGGCGTACTCATGATACGGAAAGACAGCGTCCCGAACGAA
GAAGGGTTGCTCAAGGTTTGGCTTCACGAAGAAGCCCGTGTGTTCCGCGACCGCCTAGTCGATGCAGACGACCGCATCTGGTTCAATCGCGCGTGCTCCG
AGCTGATCCAGGAGCATGTCAAGATCTCGTGGCCGCCCGAGTCGTTCGAGCACTTCTTGTACGGCGACTACCTCACGCGAGAGAACAAATCGTACCGCCC
CGTGGAGGACATGGCGCGTCTGAACGCATTGCTGATGGAGTACCTCGAGGAGTACAACATCACGTTCCCGAGCCAGATGCACTTGGTGTTCTTCAGCGAT
GCAGTGCACCACATCTCCCGCATCTGCCGTGTGCTTCGCCAGCCACGAGGCAATGCGCTGCTGGTTGGCGTTGGAGGCTCGGGTCGTCAAAGCTTGACGC
GGCTCGCGGCGTTCATGGCGGACTACAAATGCTTCTCGATCGAGATCACGCGTGGCTACGGCGCTAACGAGTTCCACGAGGACCTCAAAAAGGTACTCAT
GACCGCCGGAGCTGAGAGCAAACCGGTCGTGTTCCTCTTCTCGGACGCGCAGATTGTGCACGAGTCGTTCTTGGAGGACATCAACAACGTGCTCAATACG
GGCGAGGTACCCAACCTGTACGCGAGCGACGAGATCGAAAAGATCGTCGGCATGGTGCGCCCGCTCGCACAGCAAGTGGGCAAAGTCACGCGCGAAGACA
TCCTCCAGTACTATGTCACGCTCGTGCGCGAGAACTTGCACGTCGTGCTCGCTGTGTCGCCCATCGGTGCGGGCTTCCGCAACCGCTGCCGTATGTTCCC
GTCGCTTGTAAATTGCTGCACGATCGACTGGTTCAATGCCTGGCCGGAAGACGCACTCAACTCGGTCGCGAAGCGCTTCTTCGCTGGGAGTGCCGAAGAG
CTAGGCATTGAGCGCAACGTGGACACGCTCTGCAAGATGGCAGTCACGATCCACCGCAGCGTCGAAGAAGCCACAGCCAAGTTCTACAACCAGCTCAAGC
GCCACAACTACACCACGCCGACGAGTTACTTGGAGCTCATCAAGTTGTACGTCGACATGCTGCGCAGCCATCGGCACTTGGTACGCGCGAAGGAAGCCCG
ATATCGAGGCGGACTCAAGAAGCTCACGGAGACCGAGGAGATTGTCGGCAACCTGAAGACATCGCTGACGGACTTGCAACCCGTGCTCATGAAGGCGCAG
GAAGACACATCCGTGTTGTTGGTCCAAGTCGCGAAAGACCAAGCGGAGGCCGACAAGCAGCAGCAGTTCATCCAGGGCGACGTCGAGGCAGCCAACAAGA
TCGCAGCAGAGGTCAAGGCGATCAAGGATGACTGCCAGAAAGACCTGGACGAAGCCATGCCGGCGTACTATGCGTCGATCAAAGCACTCTCGCAGCTCAA
GAAAGACGACATCACGGTGCTCAAGACGTTCACGAACCCGCCGCGGCTTGTCGGCGTAACGATGAACGCGGTCTGCGTGCTCTTTGGCTCTAAGCAGGAG
TGGAACGAAGCCAAGAAGCTGCTCAACGATATGAAGTTCCTCGACAAACTCAAGGAGTTCGACAAGGACAACATCCCGCCAAAGACGATCCGTGCGCTTC
AGAAGTTCATGACCGACGAGGAGTTCACGCCCGAGACGCTGAGCAGCATCTCGACGGCCGCCACATCGCTCTGCATGTGGGTGCGCGCCATGTACACGTA
CGACACGGTGGCGAAGAACATCGCGCCGAAGAAAGAGAACTTGCGGCAGGCGGAAGAGCGGCTCGAGAAGGAGCAGCAACAGCTTGACGTCAAGCAGTCC
GGGCTCAGCGAAGTCTTGAAAAAAGTTGCAGACTTGAAACGAACACTCGAGAATGCTCAGCAGAAGAAGATCGACCTGGAGAAACAGACCCAGAAGACTC
AGGCGCAGCTCGTGCGTGCTGAGCGGCTCATCGACTCGCTCGGTGAAGAGCAAGGGCGATGGAAGGAGTGCGCCGAGAACCTGGCAGTTGACATGGTGAA
CCTCGTCGGGGACATGATCTTGTCTGCTGGCTGCATTGCGTACTTGGGGCCGTTCACATCAGAGTTTCGCCACGAATTGCAGATGAAGTGGATCCGCTTC
TGCAAGGAGAGTGGGCTGCCAGTGGATGGCAACTTCTCGTTCCAGCGGGTGCTTGCTGACCCTGTGGTCGTCCGCGAGTGGAACATCATGGGTCTTCCAG
CTGACACATTCTCGATCGAGAATGGTCTCTTCACAACCATGGGTAGACGCTGGCCGCTCATGATCGACCCGCAGGGCCAAGCCAACAAGTGGATCAAAAA
CATGTACAAGGCGGCCAACTCGTTGCAGATCATCAAGCTGACGCAGAAAGACTTTCTACGCACGCTCGAGAACGCCATCCGGTACGGCGCACCCGTGCTG
CTCGAGAACGTGGAGGAAGATCTCGATCCGTCGCTCGAGCCCGTGCTGCTGAAGCAAATCTTCAAGCGAGGAGGACAGTTCTTGCTACACTTGGGGGACA
GCGACGTGCCGTACAGCGAGAATTTCCGCTTCTACATCACCACGAAGCTCGCGAATCCGCACTACATGCCGGAGATCTGCATCAAAGTGACGATTATTAA
CTTTACGGTCACAAGGACGGGGCTTGAGGATCAACTCTTGGTCGATGTTGTCCGAAGCGAGCGTCCGGACTTGGAGCAGAAGAAGAATGAGCTCACTGTC
AACATTGCTGCCGACAAGAAGCAGCTCAAGGAGATCGAAGACAAGATCTTGTACATGCTCGAGAATTCGCAAGGCAACATTCTTGACGACGAAGAGCTCA
TCGACACGCTCGCGCACAGTAAAGTGACGTCTTCGGCGATCAAGACGCGCATGGCAGAAGCTGAGACGACGTCGCTGGAGATCGATCAAACTCGAGAAGG
CTACCGCTGCGTCGCGATCCGCGGTTCGATCATCTACTTCGCGATCGCGAGTCTTGCGCTCGTGGACCCGATGTACCAGTATTCGCTTCAATTTTATCAG
AAACTGTTTGTGATGCGGCTGGAGAACTCGACCAAATCCGACGTTCTTGAGGAGCGACTGGACATTCTCACCAACGACATCACGGTGTCGATGTTCGTCA
ACGTTTGTCGTGGCTTGTTCGAGAAAGACAAGATTGTGTACGCGTTCATGGTCGCATCGAGCATCCTTCTGCAGCGTGGCGCAATCAACGCGAACGAGTG
GAACTTCTACTTGGTGGGCGACAAACGAAGCCCCGCTGCGCAAAGCGCGCTTGCATCTGTCAGCGGTCTGACGCGTCCTACCTGGCTCTCGGAACGCGTC
TGGAAAGTGTTGCTGGGACTCAAGGAAATCTCTCCCGTTTTTGACAACCTCGCAGAATCAGTGATCAGCCAAACGAACGGGTGGAAGAAAGCCATGGTCC
TCTCGGACCTGCCGCACGCGGAGCCGCTGCCTCAGCCCTGGGAGTCGAAGCTCACTAATTTCCAGCGACTTCTCGTGTTGCGTGTCTTCCGCGAAGAGAT
GCTTGTGTTTGGTACGCGCGAGTTTGTCGGCAGACAGCTGGGCAAGTTCTTCACCGAGTCACCACCGTTCGACCTCAATGGCTGCTACCGCGATTCAAAG
CCCGAGACGCCGCTGATCTTCGTGCTGTCTCCTGGTGCTGACATCAACGACTACCTGCTGGAGCTCGCCAAACAGGAAGGCAAAGAAGGCTCGGGCCTCA
AGATTATCTCGCTCGGACAGGGACAAGGCCCAATCGCAGAGGCACTTATGAAGCAGTCGAAAGAGACAGGCGACTGGGTATGTTTGCAGAATTGCCACCT
TGCTGTTTCGTGGCTGGGACGACTGGAGCAGATCCTTGAGCAGTCTCAGAGTGAGGAAATGCATCAGGAGTTCCGGTTGTGGCTCACCAGTATGCCGAGT
TCGCGTTTCCCAGTGCCGATTCTTCAGAATGGCATCAAGATCACCAACGAACCTCCGAAAGGGATTAAAGCGAACCTGGGACGCACCTTCCTCGACATGA
AGGAGTCGGATTACAACGGCTGCACCAAGCCGCGAGAGTTCAAGAAGCTCGTCTTCGCGCTCGCCTTTTACAATGCCGTGTGTCTCGAACGCCGCAAATT
CGGTGCGGTCGGCTGGAACATCCCGTACGAGTGGATGAACAGCGACCTGAAGACGGGCATGCAGCAGGTGCGGCTGTATTTGGAAGAGCAGGATACGGTG
CCGTACGTGACCCTCAACGTCATGGTCGCGGACGTTTCCTACGGTGGGCGCATCACTGATCGCTGGGACAAGCGCACGAACTCGAGCATCATGCGCAAAC
TCTTTTGCAAGGAAGTGATGGACGACGCGTATCGCTTCACCTCGTCCGACACGTACTTTGCGCCACCGGAGGGGAGTCTCGTGTCACTTCGCGAGTACGT
GAGTCTATTGCCGACAGCGGACGCTCCTGACATTTTTGGTCTTCACGCGAATGCAGACATCACGTTCCAGCAGAAAGAGACGAGTCAACTGCTCGGCACG
ATTCTCCGGATGCTCGGGGGCGGAGGCGGTGACAGCGGCGGTGGCGCTGCAGCTCAGAGCAACGACAGCATTGTGATGGAGATGGTCGTGTCGATCCAGG
AACGTATGCCTGACCTCTTTTACGAGAGCAAGGCACACGCATCCACTTTCAAAGAGGCAATGGGCGGTTCGCGGAACTCGCTCGGCGTCTTTTTGTCGCA
GGAGATGATCCGCTTCAATTTCCTCATCCGCGTCATGAAGAACACTCTCGAGATGCTCAAACGCGCGATCAAAGGACTCGTCGTCATGTCTGGCGCGCTC
GAGAAGATGTACAACGGCTTCTTGATCCAGCAGATCCCGAGAGAGTGGGAGGAGGCTGGATACCCGTGTCTGAAGCCTATGGCATCCTGGATCGAAGATT
TCTTCGCGCGTATCGCGTTCACGAACGAGTGGCTCGTAAACGGCCCGCCGCTCGCTTTTTGGCTCTCCGGGTTTTTTTTCCCCCAGGGCTTCATGACGGC
AGTAAAACAGTCGTTCTCGCGTGAGCGACAAATCGCGATCGATGCGCTTGTGGTCTCGTGTGAGACTTTGTCGAACGACCGCAACGCGTACCATGCAGCA
CCACCATTCGGAGTATACATCTACGGACTCTTCATGGAAGGCGCTCGATACGACCGCAAGGCAATGATGATCGCCGAGTCGATTCCCAACGAGCTCTTCG
ACCGCATGCCCGTGATTTGGCTCAAGCCCATGCGGCGCGAGGAATACAAGCCCGCAGATATCTACGAGTGTCCGCTGTACAAAACGTCCATTCGCGCAGG
AACGCTCTCGACGACTGGCCACTCGACGAACTTTGTTGTCGCCCTGGACATCCCGACAGACAAGAGCCAGGACCACTGGATCCGACGTGGTTGCGCGATG
CTCTGCATGCTGGACACGTAG