Transcript Name :
Pytiw_DAOMBR242034maker-piw_contig_1-fgenesh-gene-0.9
Orientation:
(-)
Number of Exons:
5
Description :
Tau-tubulin kinase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Protein kinase domain22.888PS50011
HmmSmart predictionP-Valprediction_id
Serine/threonine- / dual specificity protein kinase, catalytic domain1.2SM00220
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-781
*** None ***
PositionContextScore
633SRDRKYR|SS0.58
638YRSSRKR|SA0.638
680PAHVKKR|SS0.603
695HHHRHSR|SR0.628
744HSHSKRR|SD0.527
TypeScore
nuclear957
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein phosphorylationGO:0006468IEA
*** None ***
*** None ***
Sequence
        2897 bases(100 bases per row)
ATGGAGACGATGAACAAGAACATCCTGCTTGTACGCTCGTTCGTGTGGTGCAGCGTTGCAGTTGCACGCGGATACCAATGGTTGGTACCATGCGATGGCT
AATTGATGGATGCCCTATTGTATTGCTTGCGCGTGCTTGAATAGGCGGGCGAGGTGATCGCGGACCGGTGGAAGATCGTGGAGAAGATTGGCGAGGGTAC
GTTCAGCCAGATCTACCTGGCGTTCTCGGTGCACGACAACAAGCGCGTGGCCGTCAAGGTCGAGGCGCCGAGCTCGCTCAAGCCCGTGCTCGAGTGGGAG
AGCTCGATCCTCAAGAGCCTGCAGGACTGCGACCACGTGTGCCGCTACTTCCACCACGGCAAGCATGCTGAGAGCACGGTGCTCGTTATGGAGCTGCTCG
GCGAGAGCATGTCCATGCTGCGCGTCACGCCCGATGCGATCCACGGCGTGCCCCTCGCGCGCTGCGTCTCGGTCGGCCTCGAGGTATGTCCATTATTTAT
GTTTATTTATTGGGGCCAATTCTAACTTTTCATCGTGATTTTGTATACAGATGTTGGATTGCATTGAGGCATTCCACCGCCACGGCTACGTGCACCGCGA
CATCAAGGCGTCGAACTTTGCCATGGCCGACTCGACGAACCCGGCCAAACGGTAAGGTTTTCGTAAAAACGTCATGCCCGTAAATGCTCACGGTCAAAGC
CAACGAACTAACTGACGTGCATGTATCTTATTTTTAGGAAATATTTCATCATTGACTTTGGGCTCTCTCGGCAGCACCTGAGCGAGGACAAGAAGGTGGT
CCCAGCGCGCACACAGGCCGAGTTTCGCGGCACGTCCATGTACGCGTCGCTAAGTTCGCACCGGCGCCAGGAACTTGGGCCCAAAGACGACCTCTGGTCC
TGGTTCTACCTGGTCATGGACTTTATGCGTGGCGAGCTGCCCTGGGCCGCGGATGCGCAGAAGAAGAACCGCCAGACCGTGCTCAACCTGAAGGAGTACT
ACACGGAGAAGTGTCCGTCGCTGCTGGTCGAAGGGCTCGTGGGCGCGTCGCACTTGGTGGCGATCATGAAGTATCTCCAGTCGCTCAAGTACGACGATTC
GCCGGACTACGAGCTGCTGCGCAAGAAGCTCAAGCGCGTCGAGACTGGCTCCAAGGAGGAAGACACGATGGAACTCTGGAACGCGATCGAGTCGGAGCGC
GAGCGCGCGTTGCAGTGGGCGATGCGCGGCAAGGACGCCGTGGTCAAGGATGCCGCGGTGGCAGTGCTAGAGACGCTATTGGCCGTGGCTAGGAAGTTCA
ACACGTTCTTTGGCGTGGTTGACCTGACGGCCGAGGAGCGCGTCGAGGTCCAGGAGGTCGTGTACCAGATCGAGAAGAAAATTCGCGACGCATCACAGCT
GTTTGCCCCGCCGCCAATCGAGAGTTTCGTGAAGCGCAGGCAGTCGGAGCAGAAAGGCCGGAGCGATGCGCTGCGACGCCGACGCGAGCGCGATATCCAG
ATCCGGCAGCTGCTGGAGCACAAGGCGCGGCGTCAGAGTGGGATCTCAAGTGGGAGCACAGTGCTTCCACCAGTGACTGGTGTGCAGAATTCTAATGGAG
GAGCGATGGCAGTCAAGGCTCCTGAGGTCCTCCTGAGTGGCAAGATCGCGGACCACAGGTCGGAGGACAGCGCGATGGAGATGTCGGATGGTGAGGAGAC
AGCGACGCCCCCACAGATCGGGAAGACGCTCCTCCTCCCGAGTGATGAGCCTGTCGTGCGCAGTAGCTCTACGGTTTTCCAGAGGCCACCTGTGCCACCC
GGACCGCCGCCACAGCAGCGCTGGGCGAACCGACCGCCGTTCACGTCGTCACCGCGTCCACCGCCACCATTTCCAGCAGGAGGCTTGCGAAATGGGAATT
ATCAAGGCCAGCAGCAGCAGCCGCTTCCGCCTCCGCCATTCCCACATGGATACCCACACCCGCCAGTTGCGACTTTCATGCCACCGCTACCACCACAGCC
GCCACTGCCGCCGCCAACCACAGTGTACGCCACAAGCCACATTCCGAGCGGGAATGGGAATGGTTGGCCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTGGAGCGACGGCCGTCGACGGATTCCTTCGACCACAAT
GGTGGCAGTAGTCACCACCAGCCGCCTGGTGGTGGCCCATCTCCTTCACACGATCGACGCGAGTACGACGAGTACGAGTCGAGCAAGAGCCACAACAGAG
AGCGAAGCCGACCCAGTCGCCGCTCGCCGTCGCGCGACCGCAAGTACCGGAGCTCACGCAAGAGATCAGCTTCGCGCTCGTCGTCACGCTCTCGCTCGCC
CTCGCGCTCCAGATCTCCATCGCGTTCCCGCTCGCCGGTTCGTTCGCGCTCCAGCTCGCGATCGCGATCACCAGCGCATGTGAAGAAACGCAGCAGCCAC
CGCAGCCATCGCCACCACCACCACCGTCACTCACGGTCGCGGTCGTCGTCCGAGTCGAGATCGCGCTCGCCCGCGCGTCGGCCGTCGAGCTCGCGCCACC
GCTCGAGGTCCAAGGAGCACCACCGCAGCAGTCACCACCACTCATCGCACCGCTCGTCGCACCACTCGCACAGCAAACGGCGATCGGACGAAGACAAACG
CCGCCGCAGCCATAGTCGCGAGCGCCACCACCATCGTGACCAGTCACGTGACGACAGTGGAGCCCACCGTCGACAGTCGAGATGGCAGCCCAAGTAG