Transcript Name :
Pytiw_DAOMBR242034maker-piw_contig_1-fgenesh-gene-0.1
Orientation:
(+)
Number of Exons:
6
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Bromodomain3.9PR00503
Bromodomain3.9PR00503
Bromodomain3.9PR00503
Profile scan predictionP-Valprediction_id
Bromodomain13.492PS50014
HmmSmart predictionP-Valprediction_id
Bromodomain0.0033SM00297
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-546
*** None ***
PositionContextScore
124RFNREKR|EQ0.628
143LMMMKRR|SV0.66
335LPARLRR|KS0.588
TypeScore
nuclear826
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        2305 bases(100 bases per row)
ATGAACCTGCCTACGTACCTGGAGATCATCGCGTCGCCCATGGACCTGAGCACGATGTGGGCCAAGCTGCTGGGCGTCCAGTACGACTCGCCCGACGCGT
ACCAGAGCGACATGGTGCTCATGTTCGAGAACGCGATCGAGTTCAACAAGGAGGATACGCACGAAGACTCGGTCGGGTGCGTGTGTGTGCGTATAGTGCA
CTCTAGTATTTGCGTTTGATACTTAACGAAAGAGCTCATGTGGGCTGTGTGGTGTCACTACGTGTTGTTGTGACACAGAGAGATTGCGAAGCGCTTGCTC
AAGATGTGTGTAGACGAGTGGGAGAAGACGTTCTCCGAGGTGCGCAAATTATGCGGATATGCATGCATAGTTCTCGCACTCTTTGCTCACGCGTGGCTCT
GTATGTGGAGCTGTTTAGGAGGCGACGACGGACTGGAAGCAGGTGCTGGAGTCGCAGCTGCAGGCGCGTATGGTCGAGCGCGCGCGCAACGCAAAAATGG
TGCTGCGCTGGAAGAAAGAGTCGTTCGTCGCACGCTTCAACCGCGAGAAGCGCGAGCAGCGCCACGCAGTCGCGCAAGAAGGCGCGTGAGCGGCGCGCTG
AGGGCGCTGGTTAGGGCGGTAGACGATCTATACACTGGCACTTTATTTACGAGCAAGTCCCATGTTATATTCTGTATTCATCTCCAGTATGCCTCAGTGT
TGTTGGTTGCACTTCAACGCTCCCTCGCGAGAGTGAATGTTTTGGAATTGGCATACAAATGTTTCGATAAACTGTCCACAATCTAGCTCAGTCAACAGCA
AGAAAAGTACCAAACTTCGATCAAGTTTGAGAGGGGAAACGTCCCAAAATGCGCGCGCTTTTTGTTGTTGTTTGAAAATTGCGTTTCCAATATCAGCTGA
AGGACGTTGATGATGATGAAGCGGCGGAGCGTGTCGAGCGGCGGCGGCGCGTACGTGGACCCGCTCTTCGAGTTCGACGCGCCGCAGATGTTCGTGGACC
TGACACTGCCGCCCAAGTACCACTCGCTCGCCAGCGGCGCCGTGCCGCCGCACGACCCGTGGTTCGACCAGGTGCACGTGGCGCACAGCAAGCCGAGCTA
CGAGCTCGCGCAGGAAGAGGCCGCGGTGCAGCAGAAGAGCCACAGCGCAGAGTACGGCGGCGGTGGCGCGAGTGGCAGTGGTAGTGGCAAGACGAGCGGC
AGCAAGCGCCGCCAGAGCGGCAGCGCGAGTCTCCACGCAAAGAGCGCGGTGCTCAACCCGAACGCTGCGCTGGAGAAGGAGAACCGTATCACAGGACCGC
AGCGGCGATCGAATGCCATGCCAGTGCTTGGCGCATTGTCGAGTGGTGGTGCTGGTGGTGCGGGGGGACTGATCAATGGTAAGAGTGTGAACGCAAACAG
CGTCCAGCAGACCCGCGCCAACGTTGCCGTCGGCTCAGCATCGACTGTTGCGTCAAATGGGTTTGGATCCATTGTGAGCGGGTGCGTGGTATTATTGTGT
TGCTGATGTGCGCATGAATGTGTGTAGAGGAAGGCTCACATGTTTGCTTGATGTGATTCCTGTAGACTGCCAGCGAGACTCCGGAGGAAATCTGTGGCTG
GACCAAATGGCGACGCGTTTCCTATCACTGAGCAGGAGCCCGTAACTGTTGGGCACTCGCGAGCACCGATCAAGACGACAACCGCACCAGCTGCGGCTGT
GAACACGGTTGCGGGGGTGACGAAACCTGCTACTGACTCGTTCGCAGCTCGGAAGCGAATGTTGGCTGGTGGTTCATCTGCACAAAAAGTTCGCCAACGA
GAACGCTCGGATCCACACCCCACTGCCTCAGCACAATCTGCTAGTGCGCAGCCTCATGCTCGCTTTATGGCGCCGACTGCAAGCAGCCGAATGGCTGCGG
CTCAGAAACAGAAGTCGTCAGGACCAGGAGACGCGCAACAGCGAAGCAATACATCCAAAGCTGCACCACGGCGACCGGCGTCGACATCGTCTGGAAAGCC
AAACAGCGATCTCCACGACCTCCAAGAGCTCTTAGCGCGCCACAACAAGAAGTTCAAGGCGACGCACACGTATCAGCCGCCTCAGCACTCGGTGCGGGAT
GTTCGAGTGGTACGTTTTGGTGTCTGAGCTCTTGTGGGAGATTTTTATCGGATGCTCACGATTTTCTTTGCATATGTGTCTGTTTGTTTAGTGGGAGAAG
CAAACCCAGCAGTCGTATTACAACCTCTCGCCTGAAGACCGCATTAAGGCCAACCTTGAAATCGCAGAGCTCGTCAAGGCGAAAGATGCGAACAGCGGTC
GCTAG