Transcript Name :
Pytiw_DAOMBR242034maker-piw_contig_1-fgenesh-gene-0.14
Orientation:
(-)
Number of Exons:
5
Description :
Sulfotransferase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-666
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K08106
*** None ***
Sequence
        2471 bases(100 bases per row)
ATGGCGCCGCTCTCCTCGTCCACTGCGCGCCAGAGCGCGCCCGACCCACCACACCACGCGTGCATCCCGCTGTCACACAAGCGCGTGCCCACGGAGATGC
GCGCGCCCGGCGACCACGCACAGCTTCTCTACGCGGCGCTCGTGAGTGCGCACGTGGACGTGTCCGAGCTGCGCGCGCTGCTCACGGCGCTGCCCGCGGC
GCACTGGCAGGAGCCGCACAACCGCGCGCACAACGTGTACTTCCAGCGGCCGTTTCACGATAAGCTGGGCGTGGAGAACATCATGTGCGTCTTCTCCGAC
ACGCAGCTCGAGAGCGTGTACGTGCTGCCGCTCTACGCGCGGTACCAGGAGCACTTGGAGCGCATCTTTGCGAGAATGGGCGTGCATCCCGATCAGGTGC
GTTAGTAGTGTGCATGGTGTATATGGAATAATACACTTTTATGTGGCGTGTGTATGTGGCTGACTAGGTCTGTTTGTGTGTGTTGAGCAGGTGGTTCGCT
GTTTGTTTGCGCGCATGCCAGGCGACACGCTCATCCCGGCGCACCACGACAACGGGTACGTCTATCTCTATCGGTCTCTATTACTAAGTATAACACAAGA
CGGTAACCACAGAGCTGTTGTTATCCTATCGCTGCTGTTGCTATATGTTTCAGGCCGTGGGTGAGCAAGACCCACCGCATCCACGTGCCGATCGTCACGT
TCCCCGAGGTGGCGTTCTTGAGCGGTCCGCTGGAGAGTGCGATGACGCGTTTCGCGTTCAACGAAGGCACGATCGTGGAGCTCAACAACGCGGCCAAGCA
CTGCGTGCACAACCCGACGGCGCATCACCGCGTCCACCTCATCTTCGACTACGTGGAAGCGAGCCACGAGATCAAGCACCGCACCACGCTGCGTGCCGGA
CAGATGTGTCGCCAGGTGCGCGGCCGCGTGGAGCTTGTGGACCAAGTGGACGTTCTGGCCGAGGAGACGGCCAAGAAGCAGGCTGGCAAGCAGCTCATCG
AGATGGAGAAGCTCATTAAGGAGTGCATTAACGCCGACGCCGCCGCGGCGCTCACGACCGCGTGCCGCCATTACTTCATCGAGCAAATCAGTGGGAAACA
GTTTGTCAAAAATGTCGAGAAGCTCGTGCTCGCTGGTGGCATTGAAAGCCTGGACGAAGCGTTCACTGAGCTGTTCTGGACCAAGCTACTCGCCATGTTC
GCGCTCGTGGACGCGCGCATGTGCGACGAGCTCACGAAGGCGCGCGTAAAGATGCTCTCAGCGCCCAACTGGGTGATCATTGGTGCGCAGAAGTGCGGCA
CCACGTCGCTGTACGAGTACCTGAGCCAGCACCCGCAGGCCATGAAGGGCCGGCGCCGCGAGCCGCACTTCCTGGACTGGGCGTGGCAGGCGGCGCTCAA
GCACACGTTGACACCAGAGGACCGCGCAGCGTACGAGCCCGTGCTCGAGCGCTTCTCGCCAGCGAGTGACGGTGAACAAGTTCCTGTTGACATTGCGCTC
GAGGGCAACTCTGTCAACGACATGCGGTGCGTTTGATGTGAGGTTTCTGCTAGCGTTGACTTAGCGTGACCTGGTCTGACATTGCCTGATGGTGAACTTA
GGATCAAGTACCTGCTGTCGCTGCAGTGCGAGCGCGGCGCAGAGCTCACGCCGCCGTTTCAGATTGGCGAGTCCACGCCGAGCTACCTGCTGTATGGCGA
GGCAGTGGCAAGGCGGCTCAAGTTGCTCTACCCGGAAATCAAGCTGCTCGTGATGCTGCGCGACCCGGCCAAGCGCGCATTCTCGCACTTCCAGATGACC
GCCGACGCCACGGGCTCACCAGCACAGCTGCGCATGCGGCAGGCCGTCAAGGGTAAATCCTTTGAGCAGATTGTCGATGAGGACCTCGCGCTGCTGACCG
CGGCCAGCGTGACGTCAGACTCGCTGCTCGATGGGAACGACGCAGCGCTTGACAGTTTCCAGCGCTACGCTAACGCGCTCTCGCAGCAGCACGGCGCCCA
CTCGTACGTCGGCCGGGGGCTCTACGCGCTGCAGCTAGCGCTCTGGTTGCGCGTGTTCCCGCGCGACCAGGTGCTGGTGCTCGACCTGGACGACATGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCGAGGGCACGCAGCGCGAGGTCAGC
CGCGCGTTTGAGTTCCTGGATCTGCCGCCATACCTCGTGGAGGACACGGAACGCAAAAACACGCGCGCGTACGACCCGGTTGAGCCGGCGATCGAGCAAA
AGCTGCGCGCGTTCTACGCACCGTTCAACGAGCAGCTCTTTGAGCTCATTGGCCGCCGCTTCAAGTGGTAA