Transcript Name :
Pytiw_DAOMBR242034maker-piw_contig_1-snap-gene-0.33
Orientation:
(+)
Number of Exons:
6
Description :
Poly [ADP-ribose] polymerase 2
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Poly(ADP-ribose) polymerase, regulatory domain20.374PS51060
Poly(ADP-ribose) polymerase, catalytic domain61.159PS51059
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-644
*** None ***
PositionContextScore
6-MTRKRR|VI0.508
*** None ***
GO
Biological ProcessGO IDPrediction Method
NAD+ ADP-ribosyltransferase activityGO:0003950IEA
protein ADP-ribosylationGO:0006471IEA
*** None ***
*** None ***
Sequence
        2544 bases(100 bases per row)
ATGACTCGCAAGCGCCGTGTCATCAAGCCAGCGCCAGTGGCCACGTCCACCGCGGCGTATTCACCTGTACGCGCTACGCGCAGCAGCGTCAGCACGGCGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGTCCGCGGCGGCAGCGCTAAGTGCGCAGCTGGCGAACGCGCCACCGATTCTCTCACCACCGCTCAAGAAGCGCGTGCACACGCGC
AGCGACGCGCGCGCCGCCAAGGCCCCGAGCCTCGAGGCCGCGCTGGACGACCAGGACGACTTTGACGACGAGCAGCGCGACTACGACGGCGCCAGTGGTG
GCACTCTGCGCAGCAACGTCAAGCCGGACCCGCACCTGCCGGACCCGTACAAACGCGACGCCACCGTGCTACACTACAAAGGATCGGTCTACGACGCCAT
GCTCACGCGGGTGCGTGTTCGTATCCGGTAACGGTGTATAGTAGACATCTGACTGACTGAGATGCGCATGTACTGTTTTAACGTTGTTATAGGCGCGCGT
GCACCAGAACCAGTGCGAGTTCATCGCGCTGCAGGCGCTCGAGTACGAGCAACAGTTCTACTTGTGGACGCGCTCCGGCAGCATCGGATATATGGGCAAG
ACGCTGCTTATGGGCCCGTATGAGTGCGAGGAGCGCATCGTGGTCGAGTTCTGCATGGTCTTCTCGTCCAAGACGAGCTGCACTTGGGAGGAGCGCCACT
CGCTACAGTACCAGGAAGGGAGGTGCGTGTGTATGGTAGCATACACGTGTCAGTTCTTGTGCTGAGCTGCTCATGTGATATCTCTCTACGAGTAGCTATA
CGTGGATCGAGCTCGACTACTCCATGGGCACACCGTACTCGGACCTGTCGTTTCTCGACAGCGACTACGAGGACCCAGGGTCGCGAGCTGAAGCCACCAC
CGGCCAGAAGCGACGGAGAACGTCACGCGCGTCTTCCTCATCTACCGCAATATCTTCTACGAGTCGACAGTACAACTTCGTGAAGGACTTTTGGAACAGC
TCGACCTCATCACCTTCAAGTCATTCTTTAACGGGACACAAGCGCGCAGCAGCAGCAGTGACGGTGGAGCCACCGGCGTCGCGTCTGCATGCGGAAGTGC
AGATTTTCCTCAATCTGATCGCTGATCCGAACGAGTACTCGGCTTACAATTACTCGGAGACGGAGGAAGTGATGGAGGAGGCCCAGAAGATGCCCCTCGG
GCGGCTCTCCAAGAGGACGATCAAGCGGGTATAGTGGCTTTTTATTGGTTGGTTGACTCTTATGTTGAGCTGCTATGTTGACTCTGTTGTTTAATTACTA
CACGCAGGGCTACGAGACGTTGCAGCAAATATACGAGGCGCTGCGCACGCGCACGGCGTGTCGAACACACATTCTGAACTTGAGCAGCCACTTCTACTCG
ATCATTCCGCACCACTCGCGTCTGGACGTGATCGACACGATGGTCAAGCTCGGCAAGAAAGTCGCAATGATGGAGAGCGTGTGCGAGAACGTGCGCGGCA
TGAGCAACATGGAAGTCGTGAACGCGTGCAAGCAGCGCAACTACCTGGACGAGTGCTACGAGCTACTGGGTTGCGACATGCTCCCACTGGCCGAGACCTC
GGAAGATTATGCGTTCGTGAAGGCGTATCTGAAGAACTCGAGCTGCTGTGGCTGGAAAGACGGCACGCTGCAGCTGCTCAACGTCTTTCGCGTCTGCAAG
CCCGACGAAGACGACCGCTTCGAGCCGTACCGAGGTTTTGAGAACCGAAGAGTGAGTGCCCATTTTCGCTCTTTGACAATGTTGAAATTGTTGAAAAATG
CTGAAATTGTCGGACAAAAATGCTGAAATTGGTTTTCTCGTGTCTGTAGATTTTGTGGCATGGCAGTCGACTGAGCAACTGGCTGGGCATCCTCACGGAC
GGACTGCGCATCGCGCCGCCCGAGGTGGCGTCGAACGGACGCATCTTCGGCAAAGGTATTTATTTTACGGACAAGGCGTCCAAGGCACAAGCGTACTGCC
ACGCGAGCGCGCGCTACGGGCAGAGCAAGTGTATCTTCGTACTGAGCGAAGTGGCACTGGGCGACGTCAAGGAGATGGTGTCGTCGGACGAGAACGCCAA
GCGCTGGGTACACGTGAGCTCCGGCGGCCACACGAAGGCGTCGACATACCACAGCTGTAAGGGCGTCGGCACGTGTCGCCCGGACGCGAGCGGCGACTTT
GCGGACAAGGACGGCGCGGTCTGGCCGCTCGGCAAGCCCGTGCAAACAGCCGAGGCCACGGGTTTGAGCCACTCGGAGTACATCATTTACAACCCAGCGC
AGGCGCGCATGCGCTACGTCATCGTCGCGAAGAGCGCCTACTAG