/usr/amritdata/protein/develop/executables/log_for_browse/loglikelihood -s /tmp/images/bd_sequence_input_file_42ede68fede05ecadfafbce8e2f2e6af -m /usr/amritdata/protein/develop/executables/log_for_browse/matrix/1223558 -w 120 -web -o /tmp/images/bd_log_output_file_42ede68fede05ecadfafbce8e2f2e6af
Transcript Name :
Pytiw_DAOMBR242034maker-piw_contig_1-fgenesh-gene-0.8
Orientation:
(-)
Number of Exons:
3
Description :
NADH dehydrogenase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Ribosomal protein/NADH dehydrogenase domain6.7SM00916
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Ribosomal protein/NADH dehydrogenase domainIPR007741
*** None ***
InsideOutsideTMhelix
1-152
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K03946
K03946
K03946
K03946
K03946
*** None ***
Sequence
        690 bases(100 bases per row)
ATGAGTTGGCGCGCGCAGATCTCCCGCAGCATCCAGGAGCTGCGCTTCGTGGCCTGCGAGACGTCGCAGAGCAGCCAGGGCCTCCGGTGCGTATAGGAAC
CCGTCTTGTGCCGCCGTGCACTCTTTTCATATTGTATCTGTCGTCCTTGAACGAGACGAGAGCAATGCAAGTGGGAGTGAAAGCATCAAATATGGAGTGT
TCTAACGCGTGTTGTGTCTTGTATGCCGACTGCAGCACGTTCTTCCGCAAGAACTATGGCGAGCTCAAGATGCTGAACCCGCGCACGCCGTTCGTCTACC
GAGAGGCCGAGGAGATGGAGCCGTTCGTGTACGCGCGCTTTGGTACGTCGCTATATAATGCGGGGCTGCGTGGATATTATCTGGTGCTTACGGCTACGAA
TGCAACGACCGTTTGTGTGAATAGACTGGGGCGTCGAGAAGCAGGTGTTTGTCCAGAACAAGAGCGACAAGGAGATCCTCGACATTCTCAAGGGCCTTGT
CGAGCACGGCTTCACGCTGCCAAAGTCCCCCGAGAGCGACATCGTCGTCGCGGCACCGATCATCGAGGCCGACAAGGGCGAGGACGCCTACGATCCGATC
AACCTGACCTGGGACGGCGTCACGCTGCGCCGAAACCCGGACTTTGACATCCCGCTTGAAGAGGCCAGCAAGGTCACCGAGCAGCCATAA