Transcript Name :
Pytiw_DAOMBR242034fgenesh-piw_contig_1-abinit-gene-0.136
Orientation:
(-)
Number of Exons:
3
Description :
Transmembrane protein
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Epidermal growth factor-like domain9.767PS50026
GPS domain9.072PS50221
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
membraneGO:0016020IEA
neuropeptide signaling pathwayGO:0007218IEA
*** None ***
*** None ***
Sequence
        22263 bases(100 bases per row)
ATGAGTGCCTTTGCAGCCAAGCTCTTCTTCGTCTTGTGGTGTTGTGTGTGCAGTCAGCTTGCGTCTCGCGTCGTGAGCCTCACGGCCGACGAGGCGCAGG
CCTGGCGGAATGCGAGCGACACTTTCAACTGGCAGCAGAAGGAGCCGAATGCGCAGGTCAAAATCATCGGACACGGCGTCCAGGATGCGGACGGAAACAT
CTACTTTGTCGGATCCAAGACGTACATCACTGCAACGGACGCGGTCAGCGACCAGGACATATTTATTGCGCGCATTAATGGCGATGACACGATCGCGTGG
GCGCGAGAGGTGAGACTACGTGTCAGTGTATTGCTGTGTGAATGGGAGGACAAGATGGATCTAACTATTGCTTGTTAATTGTTAGTTTGGAACGAACGAG
ACGGACGCCGCGAGCTTCATCACGCTTGTGAACGAGACAACCACCGACAATGTTAGCGGAACAGCGACGACCACCGAGATGGTCTACGTGGTGGGGACGA
CGTGGGGGTTCATGGACGAGGGCGCCCACGCGCTCAACGGCTTCGGCCAGTTCGGAGGCCGCGACGTTGTTTTACTCAAGCTCACGCGGGACGGCGACAA
GCTCTGGACACGACAGGTTCGTGCTACTATGAACTATCGAAATTGGTTGTCCACCTAACAACCTATTTCTGCTTAATTCTGCAGTTTGGCACCACCGCGA
ACGACTTTGGCCTGGGCGTCGTGGTCGACCGCGCGTTCAACTCGCTGCTTCTCACAGGTGGCTGCATCACGGACCAGGTCAACAAGTTAGTCGAGGTCAA
AGTCGACACGGTGCTCGAGGCGCGCGAGCCCTTCGCCCAGTACGAGACGCAGCTCATGGACTCCCATACGCGGACCGGCGTGCGACCTCAACAGTACGAG
TTCGCCGCGAGTTTTAACTTTCAGGGTGACCTGCTGGACTTCACGATGGACGGCGGCATTACGATCACGCCCCGACGACAGCGCATCGAGGAGGGCGGTG
TGCAGGGCGAGTACAGTGTCGTGCTCAACCGCAAGCCGCTGAACGATGTGACTGTACGTGCAGACGTGGTGATGCTCGTCAACCCCACTGGGGCTCGTAT
CCAGCAACTGCGGCTTCCGAATGATACGAACCACCAAGTCACATTCACGAGGAGCAACTGGAACCGGGAGCAAATTGTGAAGGTCGCCGCTGTCGACGAT
GCCTTCGCTGAGGGTGTCCATTATGCTGGGATCACGCACTCAAGCTCAAGTTTCGACCCAAATTTCAATGGCTCGCAGACGCCGTTTCTCTATGGCCGAA
ACCTCACGATGCAGGTGGATGACAACGACTTTGCCGGCATCAAGCTCTCAAGAACGCACATGTACGTGGGCGAAGGAGGCATGGACGACAGCTACGACTT
GGTGCTGAGCTCCATGCCGTGGTACCCAGTCACAGTGTCGATCGTGGCCATGCATCCCAATCAAACGCGAGTCAAGACGCCACTGCTCACGTTCATGCCC
GATACCTGGAACATCTCTCAGACTGTGGTTGTCTCCGCTGTCGACGACCTGGTGTCTGAGGTTGAGTTTGGAGGGCTACACCATGGCGGGAAGTTCATCC
ATTACAGCGAAAGCAAAGACTTCCGGTACAACACACGAAGACCTCGGTGCTTTGAAATCCCCAATTGCGATCCGGCGGTTGCAACATCGTGCTTGAAGCC
GGGTCTCGTCGGTGCCCAGGTTCCCGTGCGAGTCTGCGACCTGACGACCGAGTGCAGCTTCACGCTTAGCAACGGTGCCTGTGTCTCCAACGTGCTCCCG
TCTCTATTAGGAGCTCAAACCGGTGTCCCAGCGCGCTTTGGGAGCCGTCCACTCGATCCGAGCCTCAATTCAATAGGAAGTGATGCTGCGATATCCTACA
CTGCGCTCCAGAGTCTACTGCTCCGAGAACAGGCGGATGTCAACACGTCCAGACCTCGTAGCATCACTGCGAGCCAGTTGTCGTACGTGCCGCCACCGCC
CGAGCTCCGCGGCTTCGTGCTGAGCTTCCTGGGTTTGCTCAACCTGAACCAAGTACAGCTTCTGGGCCAGAACCCCATTCGAGTTCTCCACGCGGTCTGT
GCTGGGATCGGTCGACTCGAGACCCATCGCTGGGCATTTGAAGAGTGGCCGACTGGGTACGTGAACCAGGTTTTTCAGGTCGTGTTGACAATGTTCCCGG
ACATCATTGACGAGCGGCGGGTCTGGAACTGCGGTGCGGCCGTGTTTCGACCGGGGAACAGTGTTAACGTCACCATCTGGGACAACGACCCAGGCGTGAC
GCTCTCCAGCTCTTTTCTATTGGTACTAGAAACCGACGCGGCGGACACCAGTGCCGAGGCGGAGGCTACGTATTCAATCGTGCTGAATGCCCCACCGTCT
GCTGATGGCGGCTCGCTACAGCCAGCGATATCCATGTGCAACCTTCCGGGCTCGGACGACTGCGGCTTCTGGGACGATTTCTCAACTCTAGCGGCGCAGA
TCTACAGCCAACCATCAATGCCAGCCAACGTGAGCATCGCGATCGTAGGCAATTCTCAGACTAGCGTCTCGCCATCGATCGTGACGTTCACAACGAAGAA
CTGGTTCGTACCCCAGTGGGTCAACGTCAGGGCTGTGAACGACGATATCGCAGAGGCCGAGGCCGCGTTCAGAATCACCCATCGCGTGCAGAATTCGCCC
TTTGGCTACACAAATACGACGGCCTTCTGGCTTCAGGGCACACTGCCACCACCACCCTGGCGACAATTTCCAGCCACTTGTTCTACCAATGGTGGTAACG
AGCCCCAGATGCCATACAACACGATTCCGACAGTGTTGAATGCGCCAGCTCATCAGCACGTCAACGTACGAGTCCTGGATGACGACACCGCCGGGGTTGA
AGTTATTGTCAACCAGCCAGATAATGAGCTCACCACGAAGGAGTCATCAGACACGATCGACTGGGTGGGCGACTACGCGACTGCGTTCGCGTTCAGCGAC
ATCTCGCTCTCGACAAAGTCCGCTACTGGCGCCACGGGTAGTGCGCTCGCGAGCATCCTCGTCCTGGGCGCCAACACCACGTCGTTCATGAAATTCCACC
TGCCGTCCACACACGAGGGGGACTCGAGACTCACGTTCAGCTTTGCAACTCTGCGATTCCACCAGACACCGTTCAAGATTTTCAACGTATCAGATGCCAG
CGAGGACTCGACGCTCAGCAGTAGCGATGCTGGGCTGTTCACGAAAACCTATCGGTTAAGAATCACGCTCGTTCAGAATTCGTGGACTAAGACAAGTGTG
GGCATTCAGACCTCTGGGCCTGCGTCCATTCCAGGTGATCTGGCATTCGTGGCGGCAAAGTCGATCAACGTGACCGCCTCGGTCGAGAAGAGCCGCCCAA
TTGACCTGAACGTGACCGCGCTGATTGAGCAGCTACTGCCAGTACGAGCTTCTTTGCTGTCGTTCAAGATCGAAGTGCTGGATGGCGTGGCGAACACGAC
CCAGTCGGTCACGCAAATGTGCTCGTCGCTTTTTGAGAGGAAGCTGCGGCCGACGCTGCAGTTCGGGTATCGTTTTCCGAATCTGTTGTTTCGCAATAGC
AACGTCAGTCAGAGTTCGACTGCATCTTTGGCTCTTGGACCAGCGACTGTAGCGGTTGATGGTGACCGGAATACCAATAAGACGACGTCAACGAACACCG
AGCTCGAGCCCTGGTGGGAGACGTGCCTTGACGTGACCAGGAAGGTTGGCGAGGTCGCAGTGTTCCTGCCCGAGTCCATGAATTATGTGAAGGCCAGCGA
TACAACCGGCGAGGTGCCTGTCAATATTGTCGGAATTGCGAGTCTACGTCAGTTGAGCAGCGCAACCCAGCGTTTGAAGGATGCGACGGCGTTCGGATGC
CCCGAGTCATGTCCACTGGTTCGACGCACCACTGTCCGCAAGGGTATCATCCTGTGGGACGTCCAGGCCGGGATGCGATGTCTCCGCATCTATCGAGAGG
GCACTGGTCGACTCGAAATTGTCGAAGTCGAGGCTTACAATTCGTTTGTATCGGTCACACCCACAGTCGATGGCGCAGGTCTCCGATCCCGACTAAAGAG
TGACTGGAATGCGCAGAAGGCCTCCGAGTCCTGGCGCATTCAGCAGAGTGCGAAGCGATCCGAGGACGAGAACCTGGCGATCGGCATGGCAACGCGTCAG
AGCACCACGAGTCAGGAGAGCGCATTCTCGTACCTCGCAGTGGACGGCCAAAGGGCTGCGACTTGGGACACGGCCATAATTCAGAACGCCAGTGCTGCGT
TGAACTTACAACAGAGTTTGCTGCTGGCGCCTGGGAGTACGCGTACTCTGTTGGAGGCTAGTCCGTGGTGGGAAGTGGACCTGGGGAGTGTCAAGCCTAT
CAGTAGCGTCGTACTGTATCCGTACACTGGGATGCCAGACCGGGGTTTCTGTGCCTCTACCAGTTCTTCTATCAGCAGTGGATATCCAGCATGGAGTGGG
GACCTCTATAGCTACAGTCACACAGACAGTCTGCTGATGCTCCAAGACCCGTTCCACCAGGAATTTGAAGTGTTGATCACCGACTCCTCACTCGCTACAG
CCACCGACCCGACCTCCGTGGTCGTGACGCGCAAGACCACACTCTCATTCTCATGTGAGAACGGGACAACGTCAATCGCTTGGCCAGACGCGTTCACGAA
AGGCCGGTTCGTCACAGTGCGCAAGCAGGGCCTGGGCATCCTGATGCTTAATGAGGTCCAAGTGAAACGCTGGAACCCGACCACGACACCGAGGTATCTA
CTACTAGACCTCTATGGCTTTGGAAGCAAGCCCATGGCGCTCTCCAGTATCCAGCTGTTCCCACCGACCGATTTGCTGATCACAACGGACTCTACCCATG
GGGGCTTTGCTGTGCCCATCTCCTACGAGATCCACAGTGTGAGCTCTCAGCGGGCCACCAGTGGCTCAGGTTCAGCGGTCTCTCTCAAAAGTGTGGTGAG
CAGCGACTGCTACGTGGCGGCCAGCGCGTCATTCCACGAGTGGATTGTGCTCGATCTGCTCAAGCCCACGCGCGTGGGGCTCATTGAGATGGACACGAGC
GTCGTCAAGTGCGGTGTCAACGTGGCCCAGGCCAACTCCGTCTCGATCGCAGCGTATGGCGCGCCACTCGACGGTATCAGAAGCACTCAGGCTACCAGCG
CCCTCACTGTAGCTGCTGACACCTGTGAGGTCGATGCCATGGGTGTACTCAAGGGCTCTCTATATCTGGCCTCATGTAAGGGCTTTATCTGTGGCGAATC
AGCATGTAATTCCCACCTCCGAGCCGTGGGAGCGACCTCAACATTGGTGCTGAGCGACTTCAGCGACGTCGTTCTCCTTGGCATGGTCGATTTTTTCCCG
ATGACCAGACTTCCACTGTCTTCCAACGAACACCGCGCGCTCTTGCTTCGCGACAACCCCGTCTCGCTCTGGGCCTTTGACGATTTGGTCAAGATTCCGA
TTCTCAGCACAGGCGTGGACGCAACGACCAAGCGAGCCACCGGAGCCTTCGAGTTCATTTCAACAGACGCGTCCAAGCAACTTCTGGTGGACGATGCCAA
AGAGAACACGTTCTACTCGAACGACGTGCTGTTGCAGGCTTCGATGCCCGCATTCTCGCTCGAATTTTGGGTTTTCTTGACGCAGAGTCCGTTGACTACC
GATTATGTCGACAATGTTGTCACCATTGCCACCATCGATAGTGCAAGCGTCGTGTTCGCAACCATTGGAGTCTCAAAGACCTACCCAGGCGGCTTCTTCA
GACTCGTGGACTCGGTCTCGGCAAAGAGCTGCCTGGTCTTTCTCGACGGCGATATCTACTCGCCGCCTGCCACGCAGATGTGGAGCCACGTCGTGACCTC
GTACGACCCATCGACGGCAACGATATCACTCACAATCAGCTACAACCCGCCGAATGGCAGTGGGGAAATGAGCCAGCAATATGCCAAGACGACCTGCACG
CTCGCGATGTTCAACGTACAGCACAAGACAATCAATTTTGGCTCGTACAAGCCTACGACGAGCGCTTCCAAGCTGCCTGGGTTCGTCGGCAAGTTCTCGA
ACGTGGCATGGTACTTGCAAGCTCTCGGACGCTTTGAGATCTTGGACCACTACCACGATTTCATCTCGGGGACCTCAGAACGCAAGACGTTTGCGCACAA
TTCGTACGCGCTGAAACTGAACTCCAAGCCTTTGGCATCAGTGGCGATCAGCATCAACGCTGAAGCGCAGTGCTGTCGATTCAATCTGTGCAACGTGTCC
GTGATACCGTCGTCCGTGGTGATCACGCCGGAGAATTGGCAGGAACTCACGCAGATCCACGTCCTCGCAACCAATGACCAGCTCTACGAGGGCGAACACA
GCACTCAGTTAGAGTTCCAGGCGGTAAGCAAGCCGTCTTACCAGCTCGTGTCCATGGCATCAACGCTCGACATATTGTCGCTAAGCAATGGCAGCAACAC
CACGACGGTGCTATCGAACTATGAGCGCCAAGTCTACAGATTCTACCGCGATCTTCAGCTGCGCCGCGTACTCATCGATCCACAAATTTTGAGACTTCGT
GAGAACGCGCTCATGGGTCTCCAGGTCAACTGGTCAAGCGTACACATCGACTTCGGTGTGATTGTCAACGAGGCCTACAACGAACAGCTTTATATCGACA
CGCTCACAATCGACCTCATCGACGCCAGCGTGTCAGGGATCGAGTTCTCGACCACTTCTCTCTCAGTCTCGGAGAACGGCAAGGGCAACGACTACCAAGT
CCTGTTGCTCTCCGAGCCTACGAGTCCTGTGACTGTCACCATTAGCGTCGAGGACGCCTGCTACCGAGATTGCTCGAAGATGGTGCCACTTTGTCCGTCT
CAGGCTGCGCTTAAGAATGGCAGGCCGACGCTCATCTGTGGCGACGAGAGCACGCCAACGAAGCTCTGCAACATCACGATCTCGCCCAGCGTGCTGTATT
TCTCGGGAGTGAACTGGAGTTTGCCGCAAACCGTACGGGTTGTGGCAGTCGACGATGAGCTGGACGAGGCGGACTTACACCTCACGAGCATCCATGCGAT
CTCGAGAAGCCTCGACCCAGTCTATGACAACCTGTTTCTCCCAGACATTGTCGTGGCGGTTGAGGATAACGACGTCACCAACGTTGTGTACTCGAATAAG
TACGTCACGCTTTCAGAGAAGGCCAGCAACGAGGCCACCTCGTACAAGTCGACTTGGAACTTCTCGACGACCAATTTCTACATGCTGAGTCTCGCGACCG
AGCCCTGGGCGAACGTGACCATCGCCATGAGCAACGAGGCCAACAGGTCGTGCTACCGGCCCTGTGGCTATCACTTTGACGAGCCAAAGTGTGGACTTCC
CCGCCAGCAGAGCGTCACGTCGGTGCGGCTGAGTACGAACTCGACCCGGGAGATCCATCAGATCGCGCTCAGTATCCCAAAGGTCATTGAAGTGCAGCGC
ATTGTGACGTATGCAGAGCATGTGGACCAGATCTTTCGGGTCCAAGTGACTGGCGGCTTTGTCGAAGAGGTCCAAGTGGTCACGTTCCAGCTGAGCGACT
CGTTCAAGCTCCGGTTTAAGTCTGCAGACGCGATGGCCAGCGCCATGACGTACGGAAGGACGTTCCGCATTGGCGCTTCTGACCGAGCGACGAGCTCATC
AGCTCTCGACGGGTTTGCTAGCGCAGCCCAGGTTGACAACGCACTGAACACGCTCTTCAAGATCACCAGCGGATTTCGTGTCACGCGTTCTTTGCTGTAC
GACCAGTCGACGCTGAGCTGGACCATCACTTTTGCCCGCCTTGTGAGCGAGGCCGCCACGTTCCCCAGTCTCTCTGTGACAGCAGACACGCTCTTTGAAG
GAACAATTTCTATCGTTCGGAAGAGCGTTGCAGTGACGCCAACGGGTTTCATACAGATTCGCTACGGGCCTGTAGACTCGCAACCGCTTCAAGTCCCGAT
ACTGAGTGGAGCGATTGACTTGCAAGCCTCGCTGGGGGACCTGGAAGGGATTTACACCGTCGCTGTCGCTCGTACAATCCACACAAGCGCCTACGGCTTC
GAGTACACGGTCACGTTCAAGAGCGTCGACACGTTCTATCAGCTTCAGGCAGACAACACGAGCCTATTGAGCGCACCTAAAGCCACCACCAACGTCTCGA
TTGTCGCGACCGAGACCCAGAGCCCCGAGTTAATTGGCGGCGCATTCACAGTCGCGTACCTAAGCTCGTTCAACTCGACCAACAACGTCACGCGCACGAA
CGCTCTGCCCTGGAACGCCAGTGAAAGCGTAGTGCAGAGCGAGATCTCGAGCATCAACGGCGTTGGGAACATCACGGTCTCGCGAAGAAAGCTGTCAGCA
GAGGGCGGGATGGAGTGGATCGTCGAGTTCTCTCAGAACAACGGCCAGATGGCACCGTTGACAGTGCAATCCATCAACCTCACGGGCCGAAACGTGACTG
TAGCTCTTGATACCGTGCGTGACGGCGAGTCTCTCGGTGGTACCTACGTTGTCGAGATGGGTGGACGATTCAAGAAGACGAACCCGAGCACTCAACGAGT
CTATTGGATGGACATCCCGCTGAAGAACACGAGTGCGTTGGTGTTCAACACCACGGCCATTCAGTTACAACAGGCGCTGATAAGACTCGACGTCACAGAG
TTGACTAATGTTACAAGACAAGACCTGGACTGCGACGCCTTTGCTGTCTGCAACGGGTACACGTGGACCATCAGCTACATCAACAGCCCCGGAGATGTGG
CTCCCATCAGCGTCTACGGTACCAGCACGCTCACTGGCTCGGGGGCCTCGATCTCAGCGGTCACCGTCGCCAATGGGACGTACATTGGCGGCCAGTTCTC
GCTCAAGCTCGAGCTCTACGACGTCGACACCAAGCTCTGGTACTCGGGCAAGACTTGGAACCTGCCGGTGAACGTGAGCGCCGTGGGCATGGACGAAGCT
CTCGAGGCGATCCCGTTCGTGCGCTCGAACCGTGAGGCCGAGTTTGACCCGGAGACGCGGCTCTGGCGAGGCATCAAGTTCGACAAGGGCGTCCGTGTGT
ACCGTGAAGGCCCGTACTTGGACGGCGGGTACACATGGCGCCTGGAGTGGGCGATCGAGGACTACATCCGGTTCCAGGATCTCAAGATTACGATCAACGC
GAGCCTCGTGACCCAGGAGGTCGAGTCCTTTGCTGTGCCCACGCAGTTCGACCTCCTGGGCTACCCTCGATGCTCTTCGATCCCCACTTCGCGGTTTCAA
TCGGACACGAGCGACCCGTTTGGCCTCCGAGGCTCGTGTGTCTACGATATCACCAAAGTGACGATCCAGGAACGCTTTCTATGCAACTACACTGTCGCGA
ACCCGTGGATCGTGTTCACGCCCGAGAACTGGTGCGTCCCTCAAAAGGTGCAGCTATTAGTAGTCGACGATTTCCTAGATGAGGCCACTGTGCAGAACGG
CAACGTGACGTTCTCGAACGTCACGCACACTGTGTTTAGCGACGACCTGATCTACATCAAGCTCCCACTGAGCCCCGTGGTCGTTGAGGTCGAGAGCGAC
GACATTGCCGAGGTGCTGGTCTCCGAAATGAATCTCCAGGTGCGAGAGGACGGCTTGCTAGACGCCCAGTACGAACTGTGGCTCAGGACCGAGCCGCTGT
ATAGTGTCAAAATCGTCGTGCTGCCGTGGCTCGACGGGGACAACACGGGCTGCTACAGGTTTGGCTTTTGCAACCTCACGATCCCCATTTTCGAGTATAC
CTTCACGCCACAGAACTGGGATATCCCACAGACCGTGGTAGTCAAGGCCACGGACGACGACTTGGACGAGTACGACATCCACTCCACCGGCATCTCACAC
ATCTCGTACAGTGATGACACCAAGTACCACAAGATCGCCATTCCGAGGATTAACGTGACAGTGTTCGACAACGACGTCTCGCTGCTCAAGGTGCTTAAGA
CCTCGGTCTCTGTCACGGAAGGTGGACAGTACGATAGCTATGACGTTGTGCTAGGCTCGGAACCGTTCGCCAAGGTGACAGTGGCGATAGCGAACGTGGG
TGCCGTAGGGAACTTTGCCAACACGACGCCCAGTACGCTGCTGTTCACGTGGAAGAACTGGAACGTGAGCCAGAGTGTCCGCGTTAACGCTCTCGACGAT
TTCACGCAGGACGAAGTGAACTCCAGCAGCACGCTGGTCCACACGATCGCGTCCAACGATCTCATCTACGCGAAGCTCAAGGACCTCGCGCGAGTGACTG
TCAAGATCACGGACAACGACATCTCGGGCATCTCGCTCGCCACGTACGGCATGAACGTGAGCGAGAGCAACATCACCGTGTACAAATATGGTGTGCGGCT
CAACACGGAGCCCTGGCATCCAGTAACTGTGGTTCCTGATGCAAACCACGGCTGTTATGTGCGCACGTTGTCGTCCGAGACGCTCTGTAACGCGACAGTG
TTGACTCCAAAGCTGTACTTTGGCGCAGGCAACTGGAGCTCCTGGCAGAACGTGTCGTTTCGGGCCTTTGACGACTGGCTCGTGGAGAAACCAGTGCACA
AGACGATCATCACGCACTCGACTGTCAGTAAAGATCCGTTGTATCAGGTAACCAACTACACAGGTCGCAACGGCACGCTCCAACTGCGGATCACGGACAA
CGACCTGGCGTTTGTCAAAATCTCGCTTCAGGCTGGCGGTGGGAATACAAACCGGAGCCAGCTTCACGTGGCTGAAGGTGGCTTCAACGACTCGTACCGG
ATCGTGCTCAACTCGGAGCCTTACGAGGACGTCCAGCTCGTTCTCCGACCGGCCATCGAGAGCATCGTGGATCAGAACGACAAGACCAAGTTCCTTCAAG
CCCAGGTGGGCGTGGTCTTTGGTGCGAGCTCGTCGGCAAGCTCAATGCTCTCGAATATATCTCGACCCATCCAGATCGTGTTCACGGCACTCGACTGGGA
CCAGCCTCGTGTGATCACAGTGTTTGCAATTGACGACAAGGTCGCCGAGGATCCAACACAGTTCTCGTCGATTAGCCACGCGGTCACGAGCGTCGACGCC
AAGTACAACATCTCCAACAGCTCCATAGGCGTCACGAGCGTCCAGGTGATGGTGAACGACAAGGAGGCGATCTTACCTCCGGTCCCCATCGCCGCAGTCT
TTGACGCCTCAGGCACCAAGCTCCAGGTTACATTTGACTCGATCGTGTACCACGCTGCCACCATGGCAGTGCGCACAGACCTGGCCGCCAGCGACACGCT
AAGCTCGCTTTACTCTATCAAGCTCAAGCAATTTGCGTGTAACCTTGTCTTTGACTTTGGCGCAGCGACGTACTCGCTGGGCAAAGGCGCGCTCTGCTAC
TGGCTCGACCTCAAGAACCTGCGCATGGAGCTTGGCTCGGGCGCTACGATCACGGTCAAGGACTCGCTGCTGCTGAACGAGTGCGCTGTGTTTGCGAACC
AGTACTGCCAGTCGTTCAACGTCATCCGCGCCCGTTCGACCAGTCGATCATACACCCAGGCGAGCGTGAACGTGCAAGCGCCCAGCGACATTGTAAAGCC
CAAGCCCGTGCTCATGGTGCCCGAGGACGCCGGTAGCTGTGGGACCTGGACGGTCGATGGCACGCTTTCCCAGGGTGCTGGAGGGCGTCCGTTTGCTCAG
ATGTTCTGGTTCATGCTGCCCAAGACGTTTTTCCTGACCAGTAGTCAAGGCGATGCTGACCTGAGTCTGGCAAAAGCCAAGACGGTCTATCAGAGCCTAA
GCCAATTATGTGTCAAGTATGCAGTGGACTGGAAGTCGGGCAAGTCGAGCTCCGTGTTTGTCGCCAAGGCGGACTTGAGTGCAAACCCAGACCTGGCGTT
CATGACGACGATGGCTCAACTCCGGTCAGCCTGTTACCTCCGATCCCTGGCTCAGGCTGCAACAGACTCGCTCTCGTTCAAGATGCAGATCGACAGCTCA
CTACTAGAGCCTGGAGTCGGATACTCGGTCAGCTTGGAGCTCACGAACGCCTTTGCTCAGCGCACAGTACTCATGAAGGATGTTCAGGTGCGAAGTGAGC
CCGGTCCGTCACTGTTTGTCGTGGGTGATCAGAGTCTCGAAGTCACTCGCGTGGGGGACCCAATCGTGCTCCAGGTCGATGCGACTGTGAGCTGCACGGA
GGTCATTGGCACTGTCGTGGGCTACCTCTGGACGGTTTCCAGTGCTCTTATTGGAACCAGCTCAGTGTACACCGCGGTGGACCTCAGTAAAGCCAATGTA
GCCAAGGACCCGCGTGTGTTCAAGATCCCAAGGGCCTCACTGGAGGCTGAGAGGTCCTATCGGTTCCAGGTCGAGGCGTACATGGTCAGTAGTTTGCGGT
CGTCCAACAGCACGACCGTGATCATAGTCAACGTGACGAGCGGCGTGCTGGCTGCAGTAATCACCGGTGGCAGTCGAGCCATTGGCGAACGCGACACGCT
CATACTCAACGGAACGTCGTCCTCGGATCCAGATCAGGTCTCAACCCCGTTCTCGTATCAATGGACCTGTGACGACGTGACCAACACGTCGTTGATCGAG
CCACAGCTTTGTATCAATGCGTCCGCGTCCTCGATCGACAAGCTCGTGCCTCTGGACCTCACGTTCTCCAAGAGTGCGCTGCTAAGCCTCGCGCCCTTCA
GTCTCCAGCAAAATCGGACGCTCACCTTTGCTCTGACACTGGCGAAGACCTCAGTCGCGGGCAAGACGCGAACGTCTAACACGTCCACTACAGTGTGGAC
CTCTGCAGGCAGTGTCCCGGACGTCACAGTAGCCGCATCCTCAGCCAAAGTCGTCTCATCAAGCCGCGTGGCTCTCACAGCCCAGGTCAAGTCGACGTAT
CCGTACACATCCCGCTGGGTCCAGACCCAGGGTGACCTAGTTTTGCCTAGCGACAGTGCTAACACCTCTAGTGACGCCTTCGCTCTGCCACTCACGAGCC
TGAACAACATGATAGTGAAGAACAAGCTCACTCCTGGGCTCACGTACATCTTCCGCCTCATCGCGACGGACGTGAACGGGAATCATGGCTTTGGGTCCGT
GGCCATTAAAGTCAATTCACCACCCAGCTCAGGTCACTTTGACGTGAGCCCCAAGTCTGGATACGGAGCCCAGGACCTCTTCACACTGTCCTGTGCTGAG
TGGACCGACGACCTCGAGGATCTGCCTCTGAGGTACTCGTTTGGTCTGATTGGGACTGCGGACTTTCACGTATTGGTGGCGAGCGGTTCGAACGATAGTG
GCGCCTTAGGTGCGCAACTCAAGGCTAGGACGGTGCCTATCGTCTCGGAGCAGCTCATCCCCACAGCGTCCGTGACGATGTTGCCGCCCTCAGGCTTGAA
AGCCAGCGAGAATGTCACAATCGTGGCGTTTATCAGCGATTCGCTCGGTGGTTTTGCCTTTGACAGCGAAGATATCGAGGTGTTGCTTCCTGCGGCGGCC
AAGTCGAATCCCATGAGCTTTGTCAACGGCCTCTTGGGTCTCGAGGGTGGCGCCAACGCGTCGGATGCCTCCCAGCGATCAAAGTTCCTCCTCTCAGCGG
CCTCAATCCTCCAGGGTGCTTACGCTTCAAGCTCGAACGATACAGACGGGTGCTCCACGGCGGACTCGAACGGGAAGATTTGCTCGGACCATGGCGCATG
CGACCCCGCGACGCTCAAGTGCGTATGTGTGGACGCTTACATGGGTGCCAACTGCGACTTTGAAGTCAACGCTGTGCGGACGTTGAACACCGCGATCCTC
TCGAGCCTAAGCGACTCGGCCCAAGTTGCTGAGCCCTCGGCTTCGGCGCTCTCGCAGCAGGCTCTCATCATGTCCATAGTCATCCAGTCATCTCCTGCAG
CGTTCAACCAGGACGGACTAGCCCAGGTCGCCTCGTTAAGTACCAACATTGTCGAGAATGCGTTCAGCCTCCAGGACCAAGGCGATTTCTTGGACTCGGC
TGGAAAGACCGTTCTTGACTCGTTGTCCACGGTCGTTGCGATCTCCTCTGGGACGACGACGTTCCCCGCTGTGACTGCCAGTATCTACAGCCTCAAGGGA
GGCCGTCGACTAGCGGCCACGCCGTTGGCCTCGACATCTATAGACTGTAACTTGGATACGCCCGAGAGCAACCAGACCCAGAAGACGTTCGGCAATACCA
TTGGGACGCTGCTGTCTCTCACTGCGATTGCCAGCAAAGACGCTTTACCTGACGAAGACGCAATCTGGATCTCGTCCACGCAGATCCAGGCACTCACGTC
TGCCGGTACGAGCTTCAAGGCGTCCACTGGCGGTGGATCTGGGCTGGCTGTCCAGCTCACTGAACCTGCGGTCGCTTGTCTCGAAGCCGAGCTCTTCCTC
AGTGCGTTCGTACTAACCAAACCGCCACACTCGCTCTGCTCTCTCAAAGACGCCAAGCAGCTCTCGGCCAGCACCGTGTTCGCCGTTCACTCGAAAACCG
CGCTGAATGCTGCGCTCTCGGGAGTGAACAATAGTATTGCGGTGCAGAAGCTGTCGAGCTCGAGCTTGTGTGTGATCCAGACGGCCGCCAAGGCTACGAG
TGCTGGGATTGCGACCAACGCTAGGCGAAGGCTGGCTGAGTACACCTCGGGGCTCAATGATTCGCTCACAGCCACGTACAATGGTGCAGTTACTGACCCT
GAGCTGGCGTGGCACCCACTCATCGTGCTCATGATCCCACATTTGCGGAAGCTGACTGCTATCGAACAGAGTAACTTTACAACGGCCTGTTACGTCTGGA
GCGCTCAGAGTTCCGCCTGGGATGCTGGCATCTGCTTCAAGGACGACGCTACAAGCTCAGCTCTAGCTACAGTATGCTACTGCAGTGAGATCACAAAGCT
CGAAGTGCTCGTGACTCTGGAAGAGCGACTGGACTACTACGCGCTCTACAAGGACTTGTATCGGGACGAATCCAGCTCGATTGTGCCGGCCGTGGCAGCG
GCTATGCTCTTCTGGCTCTTCCTGCTGGGCAGTCGAGTAGGTCAACGCATGGACGCGACGGATGAGACCAAGGCCAAGGATAAGACGATCAAGAGTCTCA
ATAGAGCCAAGTGGGGTGAGCTCCAGGACCGCACTGCGGGTTCGGCAGCGGGCTTGGAGGACTTCACAGCTTTCTACACCCACAAAAGGCTGGAAACGCA
AGCTCGGGTGGTCGAGAACGATTCCAATCGACTCGCTGAGCAGAGTGGTGCGGTAACCGATGCGATCACGGCCGCATCTAGTGTCACACTTGGAGAGACT
GAGATGGTGATGTTGGCCGACGTGGTGACTGCTGCCACAACCATCGACCCGAATGTGACTCTCCCCAATGAAGCCAGGACACTCTTTGGCGCCACTAAGA
CGCTGGAAACCCAGTACGCGATTGCGCGCAGCTGTCTGCGATTCTGCAATGCGGTTGTGATCGTACTGGGCGTGGTCCTGGGGTTCGTAGGGCTCGACTT
CCACTTGGTGCTGGGCAACAGCACGTCCGAGCTGCTGCTGTACGTCTACGGCAAGTCTCTCGGGCTCGTTCTCCTGGTATCAGGTGGGATTCTTGTGGCT
CTGGGCGTCTTTGGGCTGGCTGTAGCGCGTGCCAAAGCCTCGCATATATCCAGAAATACGTATTTGACGCTCTTCTCGCTCGTACTGATCGCTCAACTGG
CGTTTGTGACCATCGCGTTCAAGTATCTCGACGACTTTGAAAGCATGCCCAGTGCGCTACTTTCCACACTGAGTCAAGTGTGGAACACACTTAGCGCCGA
CGTGAAGCAGGAAATCGAGACTTTCTACGGATGTTGTGGATTTCGATCAATCAAGGAAGCTAGTGCATGTCCCGAGGAATCCTTGGACGCCGTCCCACCT
CGGACCTGCTCGCATGTGCTCACTGGTCAGGCTCGTGAGTTCTTTGATCACTCGTTCGGGTACCCCCAGGTGTTCTTCCTGGTCGAGGCGATCTGTATTT
TGCTCGCAAATGTGCTCGTCCAGTGGCGCCATTTACGACTCCAGCAACTGGCGGGCGAGCCGGCATCCTCGGCCAACGGAGAGACTTCGGCCAAGCGTGC
CATGCTCCGCTCGCCACTGAACGTCGTGCTGCTGTGTACGCTGCCATCACTGTACTACCTGCTGAGCTATGTGGTGGTCTTCGCAGTTTTTTACGGGGTC
GACCTGGTCGTACAGCTCAACTTTGTATCAAATACCGTCGTGTCGGCATTGTATGGAGTCGAGATTGGCGGCCTCGTCATCGCCCTGGCGAGTGTATACC
TCGTGATCCTATTGAGAGGTATCCGCGCACTCGCATACCGTGATGTACGCGGTCTCCTATGGGTCGTGGGGCTCGCACTAGCGTTCCTGATCGTGTCCCT
TGGGGTCTCGCAGTTCTTCAATGGCATCGAGAGCAATTTGCTGCTCGACCCTGTGCTGATCGAGAAGACTGAGAGTCGCTATCTCTCGCTGCCCCGAGAC
GTACGCGTCAAGCTCGAGCTCGCGATGGAGTGCTGTGGCTTTGACTCCAACGCCGAGGGTACTTGTGCCACCGCCAGTTCTGCTTCTGATTCCAGCACCA
GTGGTGATCAGCATCTGCAGATCCGGACGTGCCGCTCGAGTGTGGAGCAGATCCTTCTAAGTGCGATCGCAATGTTCAACACGCGCGTGACTGGGATTGT
AATCGCCGAGGCTGTCGTGTTGATGCTCTCCGTGGTGCTACTCGCGAGATTCAGGCGCTTTGCAGGCAAGCAAAGCAAGATCCATCCAACGACTGGCTTG
GCCATGGCAACACCAGAGATCGACGAGTACCAGACCACATTCGACATTTTTGTGCACAATGTCTGTACGTGTACGCTCGTCCTGCTTAACCTGCTGGCGT
CCGTGCTGGGGCTCGTCGTGCTCTGGGCGGGGATTGACGCGATCTACCAGCTCAACGTGCTCCACGTCTCGTATCTGCTGCAGACCTTCGATCGGCGCAT
CGGCGTCCATCTCATCGCATTGGGCGGCGGCCTCGAGTTCTTCGCCGCTGTTGGCTTTACCGTCGCCTGGAAGCGCTCTCGTAGAATATTCCTGGTGTAC
ATGGTGACGGGTCTGGCGCTCTTCGCGGCCACATTCGGGGTCACGGGCGTCTCGTTTCGGTTCGCACACACGGCGTTCGACTCGGACGCGACCAACTTTC
GACTCGAAGAGCTCTGGACAAGCGCAGCGCCGACCACCAAGAGCTTTGTGCAGAACGCCTTCAGCTGCTGTGGCTACGAGCGCATTGTAGCTTCGAATGG
GACTGTCGTGTTCTCAGACATGGCCCAGGCTACGTTCTGGACCCAGACCAGCGAGACTTCGAGTACACCAGCGTACACAAGATCCCTCCAGGCCTCAGAA
ACAATGGCTACAGTCACAACACACCGAAAGCTCACGGAGACAAAGATCCACCAATTCACCCAGTCAACGTGTCCACCCGATGTGGACACTGGGTGCTCGG
CCGTGATAAAGCAGTACTTGGCACACCTCGCACGGTATGCGTTCAAGAGCTGTATAGCGCTGCTGAGCTTCCTGGTGCTCGTGCTCGTGAGCGCCAGTGT
TCTGTTCCTGCGCCAGGGCAAGAATACACCCTGGAAGCAGAGCTGGGCGATGGTTTACGCCCGCATGGGCCTGTTAAGCCTGTCGTTTGGCTCGATCTTC
GCGTCGCTCACGACTCTCTTCATCGCCGTGGATCTTGTCGCGCGCTGGTCGATCTTCAGTTCCAGTCTGCTGCAATTGCTCTTTGCGTTCTCGATTGGGA
TTGCGTTGTTCGTTTACGCGGCCGTGGGGCTCGGTGTGAACGTCTACTCGGTATACGCTGCCGTGGACAACGTCGTGCACCAGATCTTCTTCCAGTGCCT
CGGCCGGGGTCTCTTTGGACTCTCGCTCTGGCTCGGCGTGGCGCTCACGGGGTACCTCTCGCACCACTCTGCTGATCCCCACTGGCAAAACCAGCTGAGT
GTGTACCTGGACCGCCAGTGGAACACCCTCTCGGCCTACACGCAGCACTTGATCTCACTAGAGTACCAGTGTTGCGGATTCAACGACCCAGTGGTGGTCA
AGGGCAAAGGTATCGTCTTTGACCGGCCAGCGATTGGGTATACGTGTCCGCTGTCGAGCGCCCGCGGCTGTCAGCACGTGCTCGTGGCGCAAATCAGCTC
ATCCTTTGGATGGCTGTTTGTCTACTTGCTGAGTCTGGCGGTCGTCGAGAGCCTGCTGCTAGCGCTGAGCGTGGCGCTGCTCAAACAACTGAAGCGCATC
AAGGTGGAGGAGTGGTTCGCCATCGAGAGTCGCGTGCGCTACGTCACGGGCAAATACAAGAGCGAGGCTCGCAAGCGCCACCTGGCGCTCTCGCTCTGCC
ACTCGTACGACCCCAAGTTCACGCGCGCGCAGCGGTTGACCAGCATCCTCTGCTCAGCGCTGACTTTGTTGGCGATCTTCACTGGCTATTTTGCTACCAA
GGGCTGTCATCGCAAGTCGCTCAAGACCTGTGAGCAGCCAGACGTCTGGGGAATCCTGAGCATGGGTCTGCTCTATGGTGGCGTCTGTGGCTACGCCGCC
CAGTGCGCATGCAAGTTTGTCTTTGAGCTCGTTCGCCACCGGTGCGACGACGAGAGCTCCGAGGTCGCGGGTGCTCGGCAGCGCAAGGAGAAAGTGCTGC
TCTTCCGCAGTCTCTTCCAGCGCAGGCGCCCGAGACAACAGGGCCCGACAGCAGTGGGGACTGACTGTGTCTCAGGCGACAAGGTTGGTATTTCGAGCTC
CGCACTGACAGCCACAAGCCTGGTGCCGTCGTCCACGATGGACACGTCCCACGCCACGACCGAAGAGCGCTGGTTCACGTGGCTGCTCCGGTTCGTGTAC
CGACTCTACCATGTCGTAGCTGCTGGGCTCTTCCTGGTATCGTGCGGCATTGGTACGCTCATGGGACTCGTGCTCATTGGCTACAGTGACACGTTGTACG
GCGTCAAGATTGACCAGGGTCCGAAAGAGTTGCTCGTGCTCTCATTATTGATCGCCCTCGTGTCGCTGCTTGCGTGGCTTGCGGTCGACATGAAGGACCG
GAAGCGCAGTGGCAGCCATGTCGTGTTCGTCGTCGTGGCGATCGCGAGTTTGCTTCTCTTGACCAGTGCCTTGCTGGGCGTCTACATGGTCTATGAGGTC
ATCGACGATACGATTTCAACTACAGACCTAGCAACAGAGAACTGGTCGGTGCGCAAAACAGGCTTCAGTGTCGTCACGCGGCTCGAAGAGGCCTGGAAGG
CCAAGGCGTCCACCTACTTCCGCAATCGCGTGCAACAGGACCTCCAGTGCTGCGGCTTTCGAAGTGCCGAGGACTTTGCGTTCCGCCCATGTCCCACGGG
TACAAGTGTTCAGGTCGAGTATGAGGCACGGAGTGTCAACGGCAGTGCGCTCGTCAAGGCCCAGAACGAGATGCGCGACCTGGACGGCTGCCTTATCAAG
ATGCTCGCGTTATTCCATGGCATCGCTGACACAGTCGCGTACTTTGCAATCGGCATCTGCCTGGCGCAGTTCCTACTGGTCGTGAGCGCCGTGTTCTTGG
CCTACGATGTGGTCATCTCGAAGGACTCGAAGCTCAAGCTCCGGGTGAATGACGAGCGGCGGCAGAAGACGCAGACAGCGGACGTGCGGCAGATCTTTGA
GAAGGTCGTGGGGCTCAAGATCGCGGCCCCCGCGAGAGGCAAGATCCTCTCCAAGATGCTCTCATCCAGCCTCGACAGCGTTGGCCCCACGATCGCCTCG
GAGCTGGCGGCAGCCTCATTGGTAGCCTCGCCACAATTACAGTATGGAAACCTGCAGCAGCGCCGACCGTCAGTGTCAAGTGCCTCCAAGCTGGCGAGCC
CCAATGCGCCGGTGGGCACTGTGTTCCCACCACAACGACGCAAGTCCATCAGCCAGGTGCGCACGTCGCTAGACGGTGGCAGTAGTGCCACTAACCACGA
GGAGATCGCGAGTGTACCGTACCCCGCGTCCATAGTGTATGTGGTGTTCGCGCTCTGCGGCGTCTGGGTCGCGCTCATGCTCTACCTCGTCTTCCAGAGC
TCCATGGCGCTGGGCAAGACCACTGCGTGGTACTGCGTGCTCTGCTGGAGCGTGGGGCTTGCGTTCCACCTGCTGCTCATCGAGCCGGGCGTGATCTTCA
CTCAGATCCTCTGGTCCACACTGAGCGCGTGGTGGAAAACAACGTGGTTCATGCGCGTCATCCGCTACGGTCGCGCGGCGCTGCGCATCAAACCCGACGC
CGCCACAGCCGCCGCGAGGTACTATGCATCGCTGAGTCTCTACGAGCGCATCCGCTTCAACGCGACTGTGCGCATTCAGCGGCAGCTTCTCACGCGCATC
ACCCGCCAGCGATACCTACAGCTGATCCGAGAGAAGCGCCAGGAGTCCCATCGCATGCTGGCCGAACAGCGTCGATTGACTGTCAAGAAGGCGATCGAGG
GCTTTACCGAGGACGAAGTGCGCGCCTTCGCGCTCATCTTCCAGACTGCGGACGCCGCAAACCTCGGCCTCGTGTCGCACATGGTCATCTCGCAGTCGAT
CTATGAGCTAGGCGTGCGCGTGGCGCCCGAGGTCGTGTTCAAGTTCCTTGAGAAGCTCGACCCAGCGTATGCAGACCTCGTGGACTTTGAACACTTTCTC
TACGGTATGCACTGTGTACGCATGCACCACCAGGAGGAGCAGAATGCCGCCCTAGTGGCCTCACAGACTGAGCCGGGGGACAAGAAGAGTGTTGCTGCTA
TGGCTCCCGCTGGCGGCCTTAAGGAAGAATTTGTGAGCTCGTCGGCGCGCTTTGGGCCTGGCGCCGACCCACAGTCCAGGATCTTCGTCAAGCGACAGAA
TCTGCTGCGAGAGCTCAAGGAGAAGCGCGAATCACTCAGCTACAAGCTCATGAGCAAAGTGGGCAAGCTGCCGCCACTGCTTCAACGTGGCAAGTCTGGG
GCCAAACAAGATGGTTCAGCTAGAGCGGTCCTGAAGCATGAGCTGAGTCGGGACGATGGTTCGGAGCAGAGTCTGACGCGCTCCGAGAGCACTTTAGATG
AATTACCACCCACGGGTGCGTCTGTGATTTTGCAGAACCGCAAGTTGTCACCCAAGAAGCGTGCGTTGGAGATGGTGCTCAAGAAGAAGCACAGAGACGA
CCGCGGCAAGGCTGGTGGTACTGGACGAGATGGCAGAGAAAGCGGCAGCAGATCGCTCTCGAAGACGGCGTCGTCCCCGACGCAGCGAGCCAAGACCATG
GCGCAGAACTGGAAGATACCGTCACCGCGAGGCTGGTCAGCAGCGACGAATTTAAGTGTGAAGGGTGGTCACGCACTGGAGGAACCATCGATTGGTACCG
TCGTCGGTGAAGTTAATGAGACAGTGTACAACCGAGAAGCGATTGAAACTGGTGAGACCAAGACTCACCAACCTCTGAGCGCCAATGCTGAGCCTCAAAT
CTCAGTCGAAGCAGGTGGATCGTCGTCGGTAAACGAGTCAGAGCGAGCCACGGGTGTGCTAAACGATGAAGAAGCGAAGATCACTGCACGAATCGAGTTA
GTAACTGGGCTAACTGCTGCCAACGCGGCCTCAAACGACACTGATCAGCAAGTGCCAGACGCGGACGTCGAAGGTGTGAGCCTTGTAGTGGCTCAAGAAG
GCCAAGCGCCTGTGAGTTCAGCTCATGACGACGAGGTGAAGGGATCTGTTGAGTCTCCTGAGGTACAGACGAAACAGGAAGCCCAACAGCCGGTCTTTAA
TGAAGAAAACGAGGGTGACGAAGAAGAAGAAACCAAGCAGGAAGAGCCCAAGCCGTTCGGTACGTACATGCTGCTCAACAAGCAGGCACCGAGTGCTGGG
AAGAGTAAGATCTTGGAGAAGATCCTGCAGAAGAAGAAGCTTTCCGAAACCACCACGGCTGTGGCGACTGACGACTCAGCAGAAGACGAGGTCGAGAAAG
AGAACGAGATCTCTCGAAAGGTTACTCGGGAGTTAGGAGAGGCCGCAAGAGACAGCAAACAGCCAGGTGATGGTGGCGAAGAACTCGGAACAGCAGCTAC
TGCTGAAGGCCTGAGCGAGGCGAAGAACGTCCGCCCGAAGACCTCGGAGAAGAAAGCGGCAGCGAAGAGTTCACTGGAGAAAGCGCTCAAGAAGAAGAGC
CTGGCCAACAAGTCGGGCAAGGAGAGCGGACTCCGTAAGCCTGCGACGCCCAAAGGGCATTGA